ID: 1058994614

View in Genome Browser
Species Human (GRCh38)
Location 9:110287571-110287593
Sequence CTGTGGGAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058994614_1058994620 -8 Left 1058994614 9:110287571-110287593 CCATCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1058994620 9:110287586-110287608 TCCCACAGTACTGGGATGACAGG 0: 4
1: 222
2: 14745
3: 324025
4: 261218
1058994614_1058994623 11 Left 1058994614 9:110287571-110287593 CCATCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1058994623 9:110287605-110287627 CAGGCATGAGCCACCGTGCCTGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058994614 Original CRISPR CTGTGGGAGGCCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr