ID: 1058995143

View in Genome Browser
Species Human (GRCh38)
Location 9:110292244-110292266
Sequence CCTGGGGAGCAGGCAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058995143_1058995153 16 Left 1058995143 9:110292244-110292266 CCATCCACTGCCTGCTCCCCAGG No data
Right 1058995153 9:110292283-110292305 TGGAGCCAGAGACCACCACCAGG No data
1058995143_1058995149 -7 Left 1058995143 9:110292244-110292266 CCATCCACTGCCTGCTCCCCAGG No data
Right 1058995149 9:110292260-110292282 CCCCAGGGCTGCAGCAAGCAAGG No data
1058995143_1058995152 -4 Left 1058995143 9:110292244-110292266 CCATCCACTGCCTGCTCCCCAGG No data
Right 1058995152 9:110292263-110292285 CAGGGCTGCAGCAAGCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058995143 Original CRISPR CCTGGGGAGCAGGCAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr