ID: 1058999519

View in Genome Browser
Species Human (GRCh38)
Location 9:110334131-110334153
Sequence CCCAGTAATTCTTAAAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058999519_1058999521 -10 Left 1058999519 9:110334131-110334153 CCAAACTTTTAAGAATTACTGGG 0: 1
1: 0
2: 3
3: 16
4: 179
Right 1058999521 9:110334144-110334166 AATTACTGGGAAAAATATTCTGG 0: 1
1: 0
2: 2
3: 45
4: 406
1058999519_1058999522 29 Left 1058999519 9:110334131-110334153 CCAAACTTTTAAGAATTACTGGG 0: 1
1: 0
2: 3
3: 16
4: 179
Right 1058999522 9:110334183-110334205 TGAAACTATGAGATATATACTGG 0: 1
1: 0
2: 0
3: 12
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058999519 Original CRISPR CCCAGTAATTCTTAAAAGTT TGG (reversed) Intronic
901689994 1:10966613-10966635 AGCAGTAATTTTTAAAAGTCTGG + Intronic
908243762 1:62211334-62211356 CCCAGTAATTCTCTCAAGGTGGG - Exonic
909873129 1:80769114-80769136 TCCAATAATTCTTAGATGTTAGG - Intergenic
912392105 1:109310486-109310508 CACAGCAAATCTTAAAACTTTGG + Exonic
913545718 1:119867242-119867264 CCCAACAAATCTTAAAAGTGTGG - Intergenic
915247303 1:154565581-154565603 CCCTGTATTTCTTAGGAGTTTGG + Intergenic
916873322 1:168940774-168940796 CCCAGTATTTCTTTAAGATTAGG + Intergenic
917115105 1:171595089-171595111 CCCATTAGGTCTTAAAATTTAGG - Intergenic
918636822 1:186785344-186785366 CCCTGTAATTCTAACAATTTAGG - Intergenic
918640241 1:186831219-186831241 TGCAGTATTTCTTAAAACTTTGG + Intronic
918737347 1:188082111-188082133 CCCAGAAATTATTGAAAGTGAGG + Intergenic
919524856 1:198634807-198634829 CTTAGTAGTACTTAAAAGTTAGG + Intergenic
920752281 1:208690379-208690401 CCTACTTATTCTTTAAAGTTGGG - Intergenic
923365335 1:233254953-233254975 CCTAGAAATTCTTAGAAGTTAGG + Intronic
1063980913 10:11451258-11451280 CCCAGTGATTTTTAAAAGATGGG + Intergenic
1064773073 10:18745208-18745230 CCCAGTTATTCTTAATATTTTGG + Intergenic
1068420913 10:56791776-56791798 ACCATTAATGCTTAAAAGCTGGG - Intergenic
1070976809 10:80612077-80612099 CCCATCAATTCATAAAAGATAGG - Intronic
1071357555 10:84813067-84813089 CCAAGTTGTTCTTAAAAATTTGG - Intergenic
1071745439 10:88413604-88413626 CTCAGTGATGCTTAATAGTTTGG - Intronic
1074478328 10:113793829-113793851 CCCAATAATTTTTATAAGGTTGG + Intergenic
1075194044 10:120339439-120339461 ACCTGTAATTCTTAAAAGTTAGG + Intergenic
1076070903 10:127488324-127488346 GCCAGTAATTCTTAAACCTTTGG - Intergenic
1077621087 11:3724484-3724506 TACAGTGATTCTTAATAGTTAGG - Intronic
1077627793 11:3788638-3788660 TACAGTGATTCTTAATAGTTAGG - Intronic
1077787514 11:5400552-5400574 CCAATTTATTCTTAAAAGTCAGG - Intronic
1078951354 11:16138107-16138129 ACCAGGAATTTTTAAAATTTGGG + Intronic
1079504216 11:21135088-21135110 CACAGTATTGCTTAAAAGTGGGG + Intronic
1081285900 11:41269817-41269839 CACAGTAATCTTTTAAAGTTTGG - Intronic
1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG + Intronic
1086161804 11:83730422-83730444 CTCAGTAATTCTTTATATTTTGG - Intronic
1088043622 11:105420103-105420125 CCCACTAAATCTTAAAAGTTGGG + Intergenic
1089228988 11:116953552-116953574 CTCAGTAATTCTTGTAATTTTGG - Intronic
1090971857 11:131650763-131650785 CCCAGTAATTTTTTTAAATTTGG - Intronic
1092290035 12:7154700-7154722 CCATGTAATCTTTAAAAGTTTGG + Intronic
1093418011 12:18942799-18942821 CCCAGTTATTTTTAAAAATGAGG + Intergenic
1093855460 12:24096272-24096294 CACAGTAAGAATTAAAAGTTTGG - Intergenic
1094413747 12:30196086-30196108 CCCAGTAATTCTAACAATATTGG + Intergenic
1095907883 12:47396368-47396390 CACAGTAATTCTGAAAGGCTAGG - Intergenic
1096953759 12:55504388-55504410 CCCAGTAATGTTTAAAGTTTAGG - Intergenic
1099347323 12:81518418-81518440 TTCAGTAATTCTTCAAAGCTAGG + Intronic
1099684935 12:85872892-85872914 CTAAGTAATTATTAAATGTTTGG + Intergenic
1099752563 12:86796116-86796138 CACAGAAATTCTTAAAGGTTAGG - Intronic
1100977052 12:100133343-100133365 CTCAGCATTTCTTGAAAGTTGGG - Intronic
1102037089 12:109777118-109777140 CCCAGTAGTGCTTTAAACTTGGG + Intergenic
1105749221 13:23406704-23406726 CCCATTAATTTTTTAAAGTCAGG - Intronic
1107100330 13:36583353-36583375 CCCAGTGCTTCTCAAAAGTATGG + Intergenic
1107250576 13:38355981-38356003 CCCCATAATTCTTATAATTTAGG - Intronic
1110142685 13:72150179-72150201 CAGAGAAAATCTTAAAAGTTAGG + Intergenic
1110615545 13:77537891-77537913 CCCAGCATTTCTTAAGAGTGAGG + Intronic
1111593895 13:90387118-90387140 TCCAGTAATTTTTAAAAGGATGG - Intergenic
1111807430 13:93054718-93054740 CCCACTAAATATTAAAAATTGGG + Intergenic
1113188243 13:107714770-107714792 CACAGAAATTCTAAAAAATTAGG + Intronic
1116155796 14:41203499-41203521 CACAGTAATTCATATAATTTTGG + Intergenic
1116172599 14:41422200-41422222 CCCAGTAATTTTTGAAAATAAGG - Intergenic
1116751574 14:48892396-48892418 CCTGGGAATCCTTAAAAGTTTGG + Intergenic
1117179134 14:53174539-53174561 CTCAGCAATTCTTAAGTGTTTGG - Intergenic
1118062828 14:62159680-62159702 GCCAGTCACACTTAAAAGTTGGG - Intergenic
1118426036 14:65663499-65663521 CCAAATAATACTTAAAAGTCTGG - Intronic
1118695655 14:68382435-68382457 CTTTCTAATTCTTAAAAGTTAGG + Intronic
1120922301 14:89766085-89766107 CCCAGTTATTCATAAAATTTGGG + Intergenic
1121989913 14:98546735-98546757 CCTAATAAGTCTTAAAAATTGGG - Intergenic
1123506702 15:20948234-20948256 CACAGTAATTGTAAAAAGTGTGG - Intergenic
1128433346 15:67621278-67621300 CAAAGTAATTCTTAAAGGATAGG + Intronic
1128597958 15:68969863-68969885 CCCAGTATTTCTTATAACTCAGG - Intronic
1130016850 15:80194044-80194066 AACAGTAATTCTCAAAAGGTAGG + Intergenic
1134477777 16:14590764-14590786 CCTTGTATTTCTTAAAATTTAGG - Intronic
1137807023 16:51316869-51316891 TCTGGTAAATCTTAAAAGTTGGG - Intergenic
1139083536 16:63556507-63556529 CCCATTAATTTTTAAATGTTGGG - Intergenic
1139875860 16:70145446-70145468 CCAAGTCATCCTTAAAAATTAGG - Intronic
1140197729 16:72869186-72869208 CCCAGTATTTTTTAAATGTAAGG - Intronic
1140359928 16:74335652-74335674 CCAAGTCATCCTTAAAAATTAGG + Intergenic
1141311648 16:82918944-82918966 CACATTAATTTTTAAAAATTTGG - Intronic
1144023399 17:11256716-11256738 CCAAGTATTTCTGAAAAGTCTGG + Intronic
1144524294 17:15977366-15977388 ACTAGTAATTTTTAAAAGGTTGG - Exonic
1147178032 17:38668965-38668987 CCCAGAAACTATTAATAGTTAGG + Intergenic
1150747877 17:67830978-67831000 CCCAGTAATTCTCTCAATTTGGG - Intronic
1155826993 18:30457952-30457974 CCCATTAATGAGTAAAAGTTAGG - Intergenic
1155997240 18:32343109-32343131 AACAGTAATTGTTTAAAGTTTGG - Intronic
1157241731 18:46016232-46016254 ACCAGTGATTCTTTAAAGTATGG + Intronic
1158746339 18:60204046-60204068 CCCAGAATTCCTTAAATGTTGGG - Intergenic
1160170739 18:76551551-76551573 ACAACTATTTCTTAAAAGTTTGG + Intergenic
1166610747 19:44193112-44193134 CACACAAATTTTTAAAAGTTGGG + Intergenic
1167966650 19:53153223-53153245 CCCAGTCATTAATAAGAGTTTGG + Intronic
924997174 2:372764-372786 CCCCTTACTTTTTAAAAGTTAGG - Intergenic
926346343 2:11949645-11949667 ACCAGTAATTTATGAAAGTTTGG - Intergenic
927167447 2:20338460-20338482 CCCACAAATTCCTCAAAGTTTGG + Intronic
928506357 2:31957464-31957486 AATAGCAATTCTTAAAAGTTTGG - Intronic
930542902 2:52729982-52730004 CCTAGTAATTCTTCCAAGTGAGG + Intergenic
932082226 2:68725539-68725561 CCCAGGAATTCTAAACAGCTTGG - Intronic
936748970 2:115617205-115617227 CCCAGTAATGCTTAAAACCATGG + Intronic
937650928 2:124318408-124318430 ATCAGTAATTCTTCAAAGTATGG + Intronic
938942622 2:136182326-136182348 GCCAGTGCTTCTTAAAAATTAGG - Intergenic
939062717 2:137442904-137442926 CCGAGTAATTCTTAGAACTGTGG - Intronic
940023206 2:149177994-149178016 GACAGTAATACTTAAATGTTAGG - Intronic
941997683 2:171616179-171616201 CCCAGTAATATATAAAATTTTGG + Intergenic
944998309 2:205319650-205319672 CCCAGTGATTCTACAATGTTGGG + Intronic
1168888682 20:1279392-1279414 CCCATTAATTTTTAAAAACTGGG + Intronic
1169033717 20:2432833-2432855 CTCAGTAATCCTTAAACTTTTGG + Intergenic
1172860166 20:38043393-38043415 CCCTGTAAGTCTTGGAAGTTAGG + Intronic
1173336687 20:42117750-42117772 CCCTGTGAGTCTTTAAAGTTTGG + Intronic
1173628242 20:44489746-44489768 CCCACTGATTCTTAAACATTTGG + Exonic
1178613790 21:34111923-34111945 CCCAAGAATTTTTAGAAGTTTGG + Intronic
1182724663 22:32434626-32434648 CTCAGTAATCCCTAAAAGTGAGG - Intronic
1182794895 22:32984752-32984774 CCCAGTACTTCTTTTAAATTTGG - Intronic
1183527059 22:38329438-38329460 CCAAATAATGCATAAAAGTTAGG + Intronic
1183837230 22:40464846-40464868 CCCAGTATTTTTTAAATGTCTGG + Intronic
949199098 3:1350804-1350826 CCTAGTTATTCCTAAATGTTAGG + Intronic
951482690 3:23178592-23178614 CCCAGACATTCTTAATAGCTGGG - Intergenic
952447927 3:33401326-33401348 CACATTAATTTTTAAAAGTTAGG + Intronic
953245080 3:41183527-41183549 AACACTAATTTTTAAAAGTTAGG + Intergenic
954201737 3:49027336-49027358 CCCAATAATTCTTAGCAGTATGG + Intronic
954469622 3:50681409-50681431 CCCAATAATGCTTACATGTTGGG - Intronic
955605753 3:60701442-60701464 CCACATTATTCTTAAAAGTTTGG - Intronic
956011701 3:64838615-64838637 CACAGTGCTTCTTAAAAGCTAGG + Intergenic
957228776 3:77484046-77484068 CACAGTAACTTTTTAAAGTTAGG - Intronic
957460585 3:80513766-80513788 TCCAGTAATTTGTAAATGTTTGG + Intergenic
957542322 3:81588392-81588414 ACCAGTCATTCTTGACAGTTTGG - Intronic
957668748 3:83272499-83272521 CCCATAAATTATTAATAGTTGGG + Intergenic
958958112 3:100483238-100483260 ACCAGTAATTCTCAATACTTGGG + Intergenic
959399934 3:105887473-105887495 CCAAGTAAATCTGAAAATTTGGG - Intergenic
959427443 3:106208486-106208508 ACCAGTACTTCTTAAAATGTGGG - Intergenic
959925936 3:111921901-111921923 CCAAATACTACTTAAAAGTTTGG - Intronic
965975499 3:174615234-174615256 CCCAGTCTTTCTTAAAAGTAAGG - Intronic
966414701 3:179676753-179676775 ACCAGTAGTTCTTAAAATTCAGG - Intronic
966610256 3:181860948-181860970 CCTTGAACTTCTTAAAAGTTAGG + Intergenic
966610302 3:181861485-181861507 CCTTGAACTTCTTAAAAGTTAGG - Intergenic
969512640 4:7628220-7628242 TCCATTAAATGTTAAAAGTTCGG + Intronic
972038784 4:34562414-34562436 GCCATTAATTCTAAAAACTTTGG + Intergenic
972200839 4:36713258-36713280 CCCAGTAATTCTTTGAATGTGGG - Intergenic
974411309 4:61544430-61544452 ATCAGTAGTTCTTAAAAGCTAGG - Intronic
975168559 4:71206432-71206454 GCCAATAATTCTTAACATTTTGG - Intronic
980986391 4:139699495-139699517 CCCAGAAATACTGAAAAATTAGG - Intronic
981276973 4:142911986-142912008 CCCAGTATTTGTCAAAAATTAGG - Intergenic
982643116 4:157987390-157987412 GACTGTAATTCTTAAAAGTTAGG - Intergenic
985151904 4:186955697-186955719 CCCAATAATTCTTAAATGTTGGG - Intergenic
986819736 5:11452704-11452726 CCCAGTAATTTATAAAATATCGG + Intronic
987320877 5:16768087-16768109 GCCAGTAATTCTCAAATGTCTGG - Intronic
988798037 5:34670230-34670252 ACCAGTAATTTTTAAAAGTCTGG - Intronic
989266682 5:39482877-39482899 CCCAGTACTTTTAAAAAATTAGG - Intergenic
990968920 5:61481598-61481620 CCCAGTAGTTCTCAAAAGTAAGG - Intronic
991385244 5:66081405-66081427 CAAATTAATACTTAAAAGTTTGG - Intronic
991689397 5:69211999-69212021 CCAAGTAATACTTAAGATTTTGG - Intergenic
994062829 5:95499957-95499979 CATAATAATTCTTATAAGTTTGG - Intronic
1000809343 5:165841441-165841463 ATCAGGAATTCTTAAAACTTAGG - Intergenic
1000927954 5:167216622-167216644 CCCAGTAATTTTTTAATGATGGG - Intergenic
1002841963 6:913987-914009 CCCATTTATTATTAATAGTTGGG - Intergenic
1003821967 6:9908088-9908110 CTTCGTAATTCTCAAAAGTTAGG + Intronic
1004301514 6:14462460-14462482 TCCAGTAACTTTAAAAAGTTTGG - Intergenic
1008169798 6:48189046-48189068 TCCAGTAATGCTAAAAAGTAAGG + Intergenic
1009313227 6:62184067-62184089 AACACTAATTATTAAAAGTTTGG - Intronic
1010068214 6:71710868-71710890 CCCATGAATTCTTAAAAGCAGGG + Intergenic
1012167005 6:95969017-95969039 CCCATTAATTGTTGAAAGTGGGG - Intergenic
1012606215 6:101160513-101160535 ACCAGTAATTCTAAGAAGCTTGG - Intergenic
1013934277 6:115574171-115574193 CCCACTAATTATTAGAAGCTTGG + Intergenic
1015136397 6:129877084-129877106 CTCAGTAAGTCTTAAAAGCATGG + Intergenic
1018750785 6:166803022-166803044 ACCAATAATCCTTAAATGTTGGG + Intronic
1020583003 7:10029423-10029445 CACTGTAAATTTTAAAAGTTGGG + Intergenic
1020768743 7:12359591-12359613 CCAAGTAAATCTTGAAATTTTGG + Exonic
1021317902 7:19173018-19173040 GCCACTAATTCTTAATAGGTGGG - Intergenic
1021649978 7:22823489-22823511 CCTAGAAATTCTAAAGAGTTTGG + Intergenic
1022244019 7:28540321-28540343 CCCATTAATTGTTAATAGTGTGG + Intronic
1022346227 7:29517056-29517078 GCCATTAATTTATAAAAGTTTGG - Intergenic
1024219147 7:47274090-47274112 CCCAGTAATTGTGACAAGTATGG + Intergenic
1028851015 7:95537558-95537580 CCCAGTATTTCTGAAAAGGAAGG - Exonic
1029878370 7:103778869-103778891 CCCCGTAATTTTGAAAAGCTAGG - Intronic
1030034196 7:105394614-105394636 AATAGTAATTCTTAACAGTTGGG + Intronic
1035445079 7:158935734-158935756 CACACTAATTCTTCAAAATTTGG - Intronic
1037040949 8:14232496-14232518 CTCAGTAATTCTTGAAACTTAGG - Intronic
1037351960 8:17969308-17969330 CCCAGTAATTGATAAATGTCAGG + Intronic
1041862482 8:62530339-62530361 TCAAGTAACTTTTAAAAGTTAGG + Intronic
1044122800 8:88418636-88418658 CCAAGGAATTACTAAAAGTTAGG + Intergenic
1046176384 8:110581247-110581269 CCCATTCATTATTAAAATTTGGG - Intergenic
1046902108 8:119534818-119534840 CCCAGTAAGTCTTTAAAGGATGG + Intergenic
1050723389 9:8617503-8617525 GTCAGTAAATTTTAAAAGTTGGG - Intronic
1051211450 9:14749114-14749136 CCCAGTAAATCTTAATAGAGCGG + Intronic
1051372346 9:16369392-16369414 CCCAATACTTCTTAAAAGTCTGG - Intergenic
1052108467 9:24549043-24549065 CACAGGATTCCTTAAAAGTTTGG + Intergenic
1052442761 9:28518994-28519016 CACAGTATTTTTTAAATGTTTGG + Intronic
1055094930 9:72402635-72402657 ACAAGTAATTTTTAAAAGTTAGG - Intergenic
1056669137 9:88608668-88608690 TCTACTAATTCTTAAAAATTTGG + Intergenic
1058999519 9:110334131-110334153 CCCAGTAATTCTTAAAAGTTTGG - Intronic
1062169626 9:135127709-135127731 CCCAGCAATTCTGAAAACTTTGG - Intergenic
1187389528 X:18876808-18876830 CCAACTAATTCTTAAATTTTTGG + Intergenic
1187487770 X:19720845-19720867 CCCAGTAATTCTCTAAGATTAGG - Intronic
1187850755 X:23589492-23589514 CCATGTAATTGTTAACAGTTTGG + Intergenic
1188858343 X:35224953-35224975 CTCAGTTATTTTTAAAATTTAGG + Intergenic
1189138192 X:38572019-38572041 CACAGTTATTCTGAGAAGTTAGG + Intronic
1189326521 X:40115260-40115282 CCCAGAAATAGTTAAAGGTTTGG - Intronic
1193173679 X:78366940-78366962 ACCATTATTTCATAAAAGTTAGG - Intergenic
1194074611 X:89373257-89373279 GCAAGTAATTTTTAAAATTTTGG - Intergenic
1194547885 X:95260651-95260673 ACCAGTAATGCTAAAAAGATTGG - Intergenic
1194888155 X:99344997-99345019 GACAGAAATTTTTAAAAGTTTGG - Intergenic
1195420393 X:104669009-104669031 TCAAGTAGTTCTTCAAAGTTAGG + Intronic
1195483634 X:105376416-105376438 CCCAGTAAGTATTAAAAAATAGG - Intronic
1196424513 X:115556237-115556259 CTCAGTAATTTTTACAAGTGAGG - Intergenic
1198677059 X:139142505-139142527 CTCTCTAATTCTTAACAGTTTGG + Intronic
1200730160 Y:6726856-6726878 GCAAGTAATTTTTAAAATTTTGG + Intergenic
1201351834 Y:13052486-13052508 TTCAGTAATCCCTAAAAGTTCGG - Intergenic