ID: 1058999625

View in Genome Browser
Species Human (GRCh38)
Location 9:110335150-110335172
Sequence TGTCAGTTAGGGATCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058999625 Original CRISPR TGTCAGTTAGGGATCATGGG AGG (reversed) Intronic
900714558 1:4135849-4135871 AGTGGGTTAGTGATCATGGGAGG + Intergenic
900714598 1:4136109-4136131 AGTGGGTTAGTGATCATGGGAGG + Intergenic
901863353 1:12088688-12088710 TGTTAGGTAGGGAGCATGGCAGG + Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
905006388 1:34713563-34713585 TGTCAGTCAGTGATCATGCCAGG - Intronic
908709097 1:66995113-66995135 TGTCAGGTGGGGATCACGGAAGG - Intergenic
910399563 1:86825307-86825329 TTTCAGGTGGGGATCAAGGGTGG - Intergenic
914675381 1:149904028-149904050 GGACAGGTAGGGAGCATGGGAGG + Exonic
914975461 1:152356815-152356837 TGTCAGTCAGGAATTAAGGGAGG - Exonic
915027225 1:152842475-152842497 TGACAGTCATGGATGATGGGTGG + Intergenic
918890298 1:190257915-190257937 TCTCAGTTAGGCTACATGGGGGG + Intronic
920763044 1:208804271-208804293 TGTCTTTTAGGTAACATGGGTGG - Intergenic
1065958426 10:30713588-30713610 AGTCAGTTAGGCATCATGGTGGG + Intergenic
1069061977 10:63903807-63903829 TGTCAGTTAGGGAACAATGAGGG + Intergenic
1076141328 10:128080683-128080705 TCTCAGTCAGGGAGCATGGAGGG - Intronic
1077487308 11:2845075-2845097 TGCCTGGTAGGGGTCATGGGAGG - Intronic
1082046297 11:47731549-47731571 TGTAATTTAGGGATCATAGACGG - Exonic
1085164114 11:74381078-74381100 TGTCAGTAAGTGATCATGTGAGG + Intronic
1086021176 11:82231781-82231803 GGTCAGTTTGGGATACTGGGAGG - Intergenic
1086382977 11:86277360-86277382 TGGCAGTTAGGTATCAATGGTGG + Intronic
1088896310 11:114081196-114081218 TGTCTGTGAGGGATGCTGGGGGG + Intronic
1089764401 11:120752369-120752391 TGTCAGTATCAGATCATGGGGGG - Intronic
1099154217 12:79154537-79154559 TGTCAGGTAGAGATAATGGGGGG + Intronic
1102747558 12:115262919-115262941 TGTAAATTGGGGATCATGGCAGG - Intergenic
1103014979 12:117487310-117487332 TGTTAGTCAAAGATCATGGGTGG - Intronic
1105999995 13:25712799-25712821 AGTCGGGTAGGGATGATGGGTGG + Intronic
1106290093 13:28352871-28352893 GGTCAGTCAGGGATCAGAGGAGG + Intronic
1111199426 13:84914464-84914486 TGACACTTAGGGATTATGAGAGG + Intergenic
1112958731 13:105094384-105094406 TGTTAGATAGGGAACATTGGAGG - Intergenic
1113715773 13:112506119-112506141 TTTTAGTTAGGGATCATTGATGG + Intronic
1121762026 14:96453981-96454003 CGTCAGATAGGGATGATGGCAGG - Intronic
1122403369 14:101480874-101480896 TGTTAGTCAGGGCTCAGGGGCGG + Intergenic
1123451782 15:20370911-20370933 TGTCAGTAAGGTATAATGAGAGG - Intergenic
1125853169 15:42923501-42923523 AGTGAGGTAGGGATCATTGGGGG - Intergenic
1127704717 15:61535482-61535504 TGTCAGTGATGGAGCATGGAGGG + Intergenic
1134900183 16:17931224-17931246 TGTAAGTTAGAGATTAAGGGTGG + Intergenic
1137020935 16:35426582-35426604 TGTCAGTTTGGGGGTATGGGGGG + Intergenic
1139104758 16:63815322-63815344 TTTCAGTTCAGGGTCATGGGTGG + Intergenic
1148576571 17:48716108-48716130 TGACAGTTAGTGATGATGGGTGG - Intergenic
1150566295 17:66343924-66343946 TTTCAGTGAGGGCTCATGAGTGG + Intronic
1159709636 18:71740596-71740618 TTTCAGTTAGGGATCATTGCTGG - Intronic
1162906362 19:13826282-13826304 TATTGGTTAAGGATCATGGGTGG + Intronic
1166646926 19:44539068-44539090 GGACAGTAAGGGATCATGGGAGG - Intergenic
1166790320 19:45395455-45395477 TGTCTGTTGGGGATGCTGGGGGG + Exonic
1167901567 19:52626093-52626115 TGTCTGTTTGGTATCATGAGTGG - Intronic
1168173718 19:54608001-54608023 TGACTGAGAGGGATCATGGGGGG + Intronic
1168608168 19:57776426-57776448 TCTGAGTTGGGGATCCTGGGAGG + Intronic
926485193 2:13445377-13445399 TGTCAGTAAGGTATAATGAGAGG + Intergenic
927391840 2:22604906-22604928 TGACAGCAAGGGAACATGGGAGG + Intergenic
927482126 2:23462407-23462429 TGTCAGTTGGGGATCATTTGGGG - Intronic
930780731 2:55223397-55223419 TTTCAGTAAAGAATCATGGGCGG + Intronic
930984593 2:57569768-57569790 TGTCACTGTGGGATCATAGGAGG - Intergenic
939708447 2:145483951-145483973 TGTCACTTCGGGGTCATGGAGGG + Intergenic
944677326 2:202044574-202044596 TGTTAGTTAGATATCATGGAGGG + Intergenic
945026216 2:205622230-205622252 TATCAGTTCAGGGTCATGGGTGG - Intergenic
1168786637 20:545060-545082 AGACAGTTAGGGATAATGGTTGG - Intergenic
1169293087 20:4369470-4369492 TGTCAGTTAGGGTTCAATGAAGG + Intergenic
1170709930 20:18781478-18781500 TGTCAGCTAGTGATCTTTGGTGG + Intergenic
1170787525 20:19480531-19480553 TGTCAGGTAGGCAACATGGTAGG - Intronic
1175275353 20:57764920-57764942 TGTTAGTGAGGGATCCTGGCTGG - Intergenic
1175527017 20:59641969-59641991 TGTCACTTAGGAATCCTGAGTGG + Intronic
1178188432 21:30251967-30251989 TGTGAGTCAGGAATCAGGGGAGG + Intergenic
1178584993 21:33864263-33864285 TCCTAGTTAGTGATCATGGGTGG - Intronic
1181532547 22:23525118-23525140 TTTAAGTTATGGATCTTGGGAGG + Intergenic
1181762558 22:25068140-25068162 TGGCAGTTAGGGAGCAGGGCCGG + Intronic
1182051484 22:27315926-27315948 TGTCAGGTGGGGATCATGGTTGG - Intergenic
1185187397 22:49409960-49409982 TATCATTTAGGGCACATGGGCGG + Intergenic
955918686 3:63931794-63931816 TGTCATTTAGGTGACATGGGTGG + Intronic
957334230 3:78806355-78806377 TGTCAGTGAAGGTTCTTGGGAGG + Intronic
959991403 3:112636217-112636239 TGTCTGTTAGGGAGCCTGTGGGG - Intronic
969618058 4:8265215-8265237 TGGCATTTAGGGATGAGGGGTGG + Intergenic
970664728 4:18323604-18323626 GGGCAGTGAGGTATCATGGGAGG - Intergenic
974196965 4:58587616-58587638 TGTCACTTAGGGTTCAAGGATGG - Intergenic
975694391 4:76997435-76997457 TGTCAGTTATGGAAGTTGGGGGG + Intronic
979473286 4:121125849-121125871 TCTCTGTTAGGAATCATGAGAGG + Intergenic
984647293 4:182233286-182233308 TGCCAGTGTGGGATCATGTGTGG - Intronic
990676289 5:58189635-58189657 TGTCAGTTGGAGATCAGGTGTGG + Intergenic
992209492 5:74463731-74463753 TTTCAGTTCAGGATCATGGGTGG - Intergenic
998701371 5:144703649-144703671 TATTAGTTAGGGTTCATGAGAGG - Intergenic
1002453662 5:179333232-179333254 TGTCAGTGAGGGAGCAGAGGGGG - Intronic
1006180960 6:32153333-32153355 TGTCGGTTAGGGGTCACAGGCGG + Intronic
1006855616 6:37131205-37131227 TGCAAGGAAGGGATCATGGGGGG - Intergenic
1007815607 6:44522970-44522992 TGTCAGTGGGGGATCCTGGATGG + Intergenic
1011217858 6:85024439-85024461 AGTCAGGTGGGAATCATGGGTGG - Intergenic
1014573088 6:123035707-123035729 GTTCAGTTAGGTATCAAGGGTGG + Intronic
1014715883 6:124863689-124863711 AGTAAGTTAGGAATCAAGGGAGG + Intergenic
1015651255 6:135463472-135463494 TGTCAAATAGGTATCATAGGTGG + Intronic
1019711875 7:2521552-2521574 TGTCAGTAAGAGATGCTGGGGGG - Intronic
1021664321 7:22960266-22960288 TGTCAATAAGGGGTCATAGGTGG - Exonic
1023522322 7:41060885-41060907 TGGAAGTGAGGGAACATGGGTGG - Intergenic
1028006382 7:85574571-85574593 TCTCAGTTTGGGCTCCTGGGAGG + Intergenic
1029375416 7:100174368-100174390 AGTCATTGAGGGATCCTGGGGGG + Intronic
1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG + Intergenic
1032971714 7:137172340-137172362 TGTCATTCAGGGATGTTGGGCGG - Intergenic
1033604930 7:142919913-142919935 TGCAAGTCTGGGATCATGGGGGG - Intronic
1038117007 8:24568101-24568123 TGTCAGTTTACCATCATGGGGGG + Intergenic
1043961926 8:86426668-86426690 TGCCAGTGAGCCATCATGGGTGG + Intronic
1051320476 9:15898975-15898997 TATGAGTTAGGGATGATGGCAGG - Intronic
1058999625 9:110335150-110335172 TGTCAGTTAGGGATCATGGGAGG - Intronic
1059684154 9:116618588-116618610 TGCAAGTTGGCGATCATGGGTGG - Intronic
1061219489 9:129242042-129242064 TGACAGCCAGGGATCAGGGGAGG - Intergenic
1187279865 X:17850057-17850079 ATTCAGTAAGGCATCATGGGAGG - Intronic
1192267751 X:69551404-69551426 TGCAAGTTAGGGATGGTGGGAGG + Intergenic
1194915348 X:99700443-99700465 TGTAAGTGAGGGATAAAGGGAGG + Intergenic
1195975158 X:110518883-110518905 TGTCAGTAAGAGATCATTGAAGG - Intergenic
1198180529 X:134203660-134203682 TGTCAGTCAGCTACCATGGGTGG + Intergenic