ID: 1059003815

View in Genome Browser
Species Human (GRCh38)
Location 9:110379672-110379694
Sequence CTGCTGCTGTTGAGAAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059003814_1059003815 14 Left 1059003814 9:110379635-110379657 CCTACTTATCTAGAATAGTAAGA 0: 1
1: 0
2: 0
3: 9
4: 162
Right 1059003815 9:110379672-110379694 CTGCTGCTGTTGAGAAAAATTGG 0: 1
1: 0
2: 1
3: 21
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059003815 Original CRISPR CTGCTGCTGTTGAGAAAAAT TGG Intronic
901333878 1:8431847-8431869 CTGCTGCAGCTGACAGAAATAGG - Intronic
901800626 1:11706152-11706174 CTATGGCTGTTGAGAAAAACTGG + Intronic
902442083 1:16437282-16437304 CCTCTGCTGCTGAGAATAATTGG - Exonic
909045154 1:70700733-70700755 CTGCTGCTCTTGAGATGAACAGG + Intergenic
909515139 1:76498388-76498410 CTACTACTGATGAGACAAATGGG + Intronic
909633893 1:77794416-77794438 CTGCTGCTTTTGAAATATATAGG + Intronic
910466033 1:87501128-87501150 ATGCTGCTAGTTAGAAAAATGGG + Intergenic
910559514 1:88575578-88575600 CTCCTGCACTTGAGAAATATGGG + Intergenic
911754979 1:101543705-101543727 CTGCTGCTGCTGGGTAAAAACGG + Intergenic
912678909 1:111715532-111715554 CAGCTGCAGTTCAGAAAACTAGG - Exonic
914492926 1:148163705-148163727 ATGCTGCTAGTTAGAAAAATGGG - Intergenic
916996196 1:170303945-170303967 TTGGTGCTCTTGAGAAGAATTGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917500434 1:175580093-175580115 CAGCTGCTGGGGAGAAAAGTGGG + Intronic
918157339 1:181861511-181861533 CTCCTGGTGATCAGAAAAATTGG + Intergenic
918266758 1:182849637-182849659 GTGCTAATGTTGAGAAACATTGG + Intronic
919197507 1:194307120-194307142 CTGCTGCTGCTCAGAGATATGGG - Intergenic
920544373 1:206803230-206803252 CTGTTGCTGCTGAGAGAACTTGG + Intronic
920756149 1:208735645-208735667 AGGCTGGTGTTGAAAAAAATAGG + Intergenic
922872326 1:228912853-228912875 CTGCTGCTGCTGGGAATAAAGGG + Intergenic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
923954329 1:238997584-238997606 CTGGGGCTGGAGAGAAAAATTGG + Intergenic
924031999 1:239895132-239895154 CTACTGCTGCAGAGAAAAAGAGG - Intronic
924699773 1:246439443-246439465 CTGCTTCTGTTCTAAAAAATGGG - Intronic
1063081506 10:2772182-2772204 GTGCAGATGTTGAGAAATATAGG - Intergenic
1063092806 10:2882703-2882725 ATTTTGCTCTTGAGAAAAATGGG + Intergenic
1063810347 10:9697770-9697792 CTTTTGCTGGTGGGAAAAATGGG - Intergenic
1068359826 10:55962871-55962893 CTGATACAGTTGAGAATAATTGG - Intergenic
1070709238 10:78666242-78666264 CTGCTGCTGTTCACAAACCTGGG + Intergenic
1070948766 10:80414095-80414117 CTCATGGAGTTGAGAAAAATGGG + Intronic
1071314018 10:84374255-84374277 CTGCTGCTGTTGAGAAACCTTGG + Intronic
1071853307 10:89598028-89598050 ATGCTGCTGTTGAGAAACCCTGG - Intronic
1072452708 10:95551448-95551470 CTGCTCCAGTAGAGAAAAAGGGG + Intronic
1073722328 10:106186980-106187002 CTGATGCTGTTGGGTAAAAATGG - Intergenic
1074604634 10:114949317-114949339 CTGCTGCTGATGAGGCAAACAGG - Intronic
1074624634 10:115167618-115167640 GTGCTGTTGTTAAAAAAAATTGG + Intronic
1074848554 10:117420430-117420452 CTGATGGTTTTCAGAAAAATGGG + Intergenic
1076167048 10:128291095-128291117 CTGCAGCTGTTGTAACAAATTGG + Intergenic
1076537920 10:131194744-131194766 CTGATGCTGTTGAGAAAACAGGG - Intronic
1076870940 10:133194453-133194475 CTGCTACTGTTGTGGAAACTGGG + Intronic
1079948912 11:26777532-26777554 CTGCTGCTGTTGCAAGAAATAGG + Intergenic
1080074627 11:28134546-28134568 CAACTGCTGTTGCGAAAAAGTGG + Intronic
1080159126 11:29150867-29150889 CTGTTGCTGGTGATAAAATTTGG + Intergenic
1083824878 11:65194942-65194964 CTGCTGCTTTGGAAAACAATTGG - Intronic
1086777097 11:90850844-90850866 TTGCTTCTCTGGAGAAAAATTGG - Intergenic
1087163187 11:94971391-94971413 CTGCTGCAAGAGAGAAAAATAGG - Exonic
1089496004 11:118909067-118909089 CTGCTGGTGTTGGGACATATGGG - Intronic
1089781349 11:120875331-120875353 CTGCTGCTGTTGGGGATAACTGG - Intronic
1090158698 11:124468477-124468499 CATCTGCTGTTGATAACAATGGG + Intergenic
1090214195 11:124946527-124946549 CAGATGCTATTGAGAAAACTGGG + Intergenic
1093443303 12:19225593-19225615 TTGCTTCTCATGAGAAAAATGGG - Intronic
1094385613 12:29889821-29889843 CTGCTGCTGTGAAGAAAGATTGG + Intergenic
1097137881 12:56874624-56874646 CTGTTGCTATTAAGACAAATAGG - Intergenic
1097379940 12:58882735-58882757 CTGCTGAGGTAGAGGAAAATGGG - Intronic
1097577434 12:61412585-61412607 TTGAAGCTGTTGAGAAAAAAGGG + Intergenic
1097808172 12:63988403-63988425 CTGATGGTGTTAAGAAAAAAGGG + Intronic
1100090061 12:90957304-90957326 CTGCTTCTCTTAAGAAAATTCGG - Intergenic
1101938953 12:109084609-109084631 GTGCTGCTGTTGAGAAACCTTGG + Intronic
1102900529 12:116633161-116633183 GTGCAGACGTTGAGAAAAATTGG - Intergenic
1103475123 12:121212198-121212220 CTGCTGCTGCTGACAGATATTGG - Intronic
1104102641 12:125628222-125628244 CAACTGCTGTGGAGAAAATTTGG - Intronic
1104434008 12:128741382-128741404 TTGTTGCTGGGGAGAAAAATTGG + Intergenic
1104465849 12:128989725-128989747 CAGCTGCTATTGAGACAAACTGG + Intergenic
1104549279 12:129741454-129741476 CTGCTACTCATGAGAAAAAGAGG + Intronic
1104653402 12:130555206-130555228 CTGCCTCTGTTGAGATGAATCGG + Intronic
1105407886 13:20146360-20146382 GTGCACCTGTTGAGAAACATGGG + Intronic
1105542006 13:21324009-21324031 CTGCTGCTGTTTTGTATAATAGG + Intergenic
1107384628 13:39894574-39894596 CTGCTGCAGGTGAGAAAGGTGGG + Intergenic
1108475123 13:50808637-50808659 CTGCTGCTGTTGAGTAGATGAGG + Intronic
1108697141 13:52912538-52912560 CTGCTGCTCTAGAGAAATAAGGG - Intergenic
1109688744 13:65857017-65857039 CTTCTCATGATGAGAAAAATAGG + Intergenic
1110855977 13:80297130-80297152 CTGCTGATTTTGAGAAATAGGGG - Intergenic
1115956654 14:38788129-38788151 CTGCTGCTGTTGATCACAAAAGG - Intergenic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1117511068 14:56451606-56451628 CTGCTGCCATTTAGAAACATTGG + Intergenic
1117664275 14:58040118-58040140 GTGGAGCTGATGAGAAAAATTGG + Intronic
1117989875 14:61422790-61422812 CTGCTTCTTTTAAAAAAAATGGG - Intronic
1119819490 14:77602370-77602392 GTGATGCTGTTGACCAAAATAGG - Intronic
1120343430 14:83251853-83251875 CTGCTGCTGCTGCTAAAAGTCGG + Intergenic
1120802455 14:88706768-88706790 CTGCTTGGGTTGAGAATAATGGG - Intronic
1121040105 14:90739383-90739405 GTGCTGCTGCTGAGAAAGGTGGG - Intronic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1122386285 14:101350481-101350503 CTCCTGCTGCTCAGAAAAAAGGG + Intergenic
1124255525 15:28139215-28139237 CTGCTTCTGATGAGCAGAATAGG + Intronic
1124568762 15:30840187-30840209 CTGCTTCTGATGAGCAGAATAGG - Intergenic
1125184480 15:36914778-36914800 TTGCTGCGGTTGAGGAAAGTTGG - Intronic
1127603298 15:60560769-60560791 CAGCTGCTGCTGGGAAAAAATGG - Intronic
1127615535 15:60681738-60681760 CTCCTCCTGGTGAGAAAAACAGG - Intronic
1128159787 15:65416070-65416092 CCTCTGCTGTTGAGAGAATTTGG - Intronic
1128925106 15:71648192-71648214 CTGGTGTTGTTGAGAGAATTAGG + Intronic
1129071933 15:72958891-72958913 CTGCTGGTGGTGACATAAATTGG - Intergenic
1130037569 15:80375696-80375718 GTGCCGATGTTGAGAAAACTTGG - Exonic
1134416681 16:14049195-14049217 GTGCTGAGGTTGAGAAAACTTGG + Intergenic
1134771067 16:16810072-16810094 CTCTTGCTTTTGAGTAAAATAGG + Intergenic
1137001169 16:35232428-35232450 CTGCTGCTGTCCAGGAACATGGG - Intergenic
1139807947 16:69585391-69585413 GTGCAGCTGTTGTGAAAAACAGG + Intronic
1140140806 16:72255646-72255668 CTGCTCCTGTTGAAAACATTTGG - Intergenic
1140359925 16:74335626-74335648 CTGCTGAGGTTGAGAAAATCAGG + Intergenic
1141103280 16:81213351-81213373 CTTCTCCTGTTGAGAAAGGTTGG - Intergenic
1141486883 16:84346262-84346284 CTGCTGCTCTAGAGAGAAACAGG + Intergenic
1141626931 16:85266341-85266363 CTGCTTCTGTTGAGCCAAATTGG + Intergenic
1144237388 17:13274805-13274827 CTGATTCTGATGAGAAAAAAAGG + Intergenic
1144406919 17:14960849-14960871 CTGCTGATGTTGAGAACCACTGG - Intergenic
1144502978 17:15805764-15805786 CTGCTTCAGTGGAAAAAAATAGG - Intergenic
1145165164 17:20608466-20608488 CTGCTTCAGTGGAAAAAAATAGG - Intergenic
1148645631 17:49218318-49218340 CTGCTGTTGGTGAGAAGAAGCGG + Intronic
1149973220 17:61240094-61240116 CTGCTGCTGTTGAGACAGCATGG - Intronic
1153287367 18:3468971-3468993 CTGCTGCTGTTGTAAGAAACTGG - Intergenic
1153856684 18:9155565-9155587 CTGCTGATGGGGATAAAAATTGG - Intronic
1154229244 18:12539626-12539648 CAGCTACTATTAAGAAAAATAGG + Intronic
1160735487 19:660457-660479 CTGCTGCTGCTGAGACACCTGGG - Intronic
1161137057 19:2626144-2626166 CTGCTTCTGTTTGGTAAAATGGG - Intronic
1161233999 19:3189068-3189090 CTGCTGCTGTTGAGAGGCACAGG + Intronic
1161878186 19:6928128-6928150 CAGCAGCTGTGGAGAGAAATAGG - Exonic
1161954366 19:7484803-7484825 CTGCCTCTGTGGGGAAAAATTGG + Intronic
1162630115 19:11920928-11920950 CTGCTGCTGAGGGTAAAAATTGG - Intergenic
1163137575 19:15323874-15323896 CTGGGACTGTTGAGAAAGATGGG - Intronic
1164856228 19:31526698-31526720 CTGCTGGTGTTGACACAGATGGG - Intergenic
1166902723 19:46078281-46078303 CAGCTGCTGTGGAAAACAATGGG + Intergenic
1167137754 19:47627583-47627605 CTGCTGCTGTTGATACTAAGAGG + Intronic
1168538308 19:57190489-57190511 GTGCTGCAGCTGAGGAAAATGGG - Intergenic
925051990 2:822767-822789 CGGCTGCTGTTGAGACAGACAGG + Intergenic
925675971 2:6361143-6361165 CTGCTGCAGATGAGAAGACTGGG - Intergenic
926144556 2:10388743-10388765 CTGCTGCTGGTGACAAAGATGGG - Intronic
926909622 2:17839665-17839687 CTGCTGATGGTGAAAAAATTTGG - Intergenic
927618221 2:24622247-24622269 GTGCTGTTGTTGAGAAACAGTGG - Intronic
928862744 2:35878324-35878346 CTTCTCCCGTTGAGAATAATGGG + Intergenic
933010764 2:77059864-77059886 CTGCTGCTCTTGAGAGAAGTTGG - Intronic
933306467 2:80606081-80606103 CTGCAGATGTTGAGAAGAGTTGG + Intronic
935210010 2:100931342-100931364 CTGCTGCTGTTATACAAAATTGG - Intronic
936122554 2:109759476-109759498 CTGAATCTGTTGAGAAAAAGAGG - Intergenic
936222139 2:110611996-110612018 CTGAATCTGTTGAGAAAAAGAGG + Intergenic
938109404 2:128553900-128553922 CTGCTGGTGTTGAAAACAAATGG + Intergenic
938215391 2:129508543-129508565 CTGTTGCTGTTGGCATAAATTGG - Intergenic
938684784 2:133727680-133727702 CTGCTGCTGTGGAGTAAGAGAGG - Intergenic
939011434 2:136851349-136851371 GTGCTGCTGTTAAGAGACATGGG - Intronic
940083069 2:149826868-149826890 ATGGTGCTGTTGAGAACATTTGG + Intergenic
940433723 2:153625671-153625693 CTGTTGCTGAAGAGAAAAAATGG + Intergenic
942985020 2:182130459-182130481 TTGCTACTTTTGAGAATAATGGG - Intronic
944435705 2:199687364-199687386 TTGCTACTGTAGAGAAACATTGG - Intergenic
945907979 2:215615483-215615505 CTGCTGCTGGTGGAACAAATTGG + Intergenic
946377896 2:219324861-219324883 CTGAGGCTGCTGTGAAAAATTGG - Intergenic
946739252 2:222785588-222785610 CTGCTGTTGCTGAGAAATCTCGG - Intergenic
946962252 2:224997534-224997556 GTGCTGCTGTTAAAAAGAATAGG - Intronic
1168809512 20:695270-695292 CTGCTGCTGTACAAAAGAATGGG - Intergenic
1168990034 20:2087199-2087221 CTGTTGCTGTAGAAAAAATTGGG + Intergenic
1169603509 20:7289757-7289779 ATGTTGCTGTAGAAAAAAATGGG + Intergenic
1171124828 20:22592630-22592652 ATGCTAATGTTGAGAAACATGGG + Intergenic
1171186133 20:23125674-23125696 TTGCTCCTGTTGAGAAATGTGGG - Intergenic
1173196744 20:40920351-40920373 TTGCTGCTGTCAAGAGAAATGGG - Intergenic
1173273448 20:41557350-41557372 ATGCTCCTATTAAGAAAAATGGG + Intronic
1175494227 20:59403065-59403087 CTCCTGCTCTTTAGAAAAAGGGG + Intergenic
1175875017 20:62225306-62225328 CAGCTGCTGGTGAGTAATATGGG + Intergenic
1176862599 21:14019933-14019955 CTGATTCTGTTGATAAAAATGGG + Intergenic
1177938360 21:27378269-27378291 TTGCTGCTTTGGAGTAAAATGGG - Intergenic
1178811831 21:35890933-35890955 CTTCTGCTGTTGAGAGAAAAGGG - Intronic
1181340068 22:22171705-22171727 CTGGACCTGTTGAGAAAAACAGG - Intergenic
1181759425 22:25048044-25048066 CTGATGCAGTGGAGAAAAGTGGG + Intronic
1182582348 22:31321771-31321793 CTGGTGCTGTGGAGAAAGATGGG - Intergenic
1182800335 22:33026838-33026860 CTGATGTTGTTGAGAAAACGTGG + Intronic
949202943 3:1402141-1402163 TTGCTCCTGTTAAGAAAAAGAGG - Intronic
949732142 3:7125915-7125937 TTGCTTCTGTTGATAGAAATGGG + Intronic
951041074 3:17989387-17989409 CTGCTGTAGATGAGAAACATGGG + Intronic
951169922 3:19529230-19529252 ATGCTGCTGTTGAGGTAAGTGGG + Intronic
951581815 3:24172658-24172680 CTGGTGCAGTGGAAAAAAATTGG + Intronic
951955903 3:28253134-28253156 TTTGTGCTGTTGAGAAAAACTGG + Intronic
952156554 3:30649693-30649715 CTGGTTCTGCTGAGAAAAACGGG - Intronic
952339469 3:32433348-32433370 CTGCACCTGTTGTGAGAAATCGG + Intronic
953256957 3:41300042-41300064 CTGCTGGTGTTGGTGAAAATTGG - Intronic
953350449 3:42211475-42211497 CTGGTGCTGATGACAAAAATGGG - Intronic
953570339 3:44066472-44066494 CTGCTGCTGTCCAGAAAGAAGGG - Intergenic
955302842 3:57799656-57799678 TTGCTTCTGTGGAGGAAAATGGG + Intronic
956053769 3:65277190-65277212 CGGCTTCTGTTGACAACAATTGG + Intergenic
957200558 3:77129655-77129677 GTGTTGTTGTTGAGAAGAATTGG + Intronic
958104116 3:89051017-89051039 CTGGCTCTGTTGAGAAAAGTCGG + Intergenic
959285775 3:104407850-104407872 CATTTGCTATTGAGAAAAATGGG + Intergenic
960493809 3:118351209-118351231 CTGGTGGTGTTGAGACAAAATGG - Intergenic
961006803 3:123411021-123411043 CTGCTGCTTTGGAGATAAGTGGG - Intronic
961479146 3:127168350-127168372 CTGCAGCTGTTGAGTGCAATGGG + Intergenic
962247476 3:133808226-133808248 CTGCTTCTGAGGAGAAAACTAGG - Intronic
962353147 3:134670526-134670548 ATGATGCTGTTGAGAATAAATGG + Intronic
963942682 3:151110858-151110880 CTGCTGCTGTTGAGCCAAGATGG + Intronic
964159645 3:153631509-153631531 ATCTTGCTGATGAGAAAAATGGG - Intergenic
964667107 3:159186830-159186852 ATGCTGCTGGTGAGAGAAAACGG + Intronic
965653113 3:170953902-170953924 CTGCTGCTGCCGAGCAAAACCGG + Intergenic
972654729 4:41053477-41053499 CTGCTGCTTTTAAGAAATTTGGG - Intronic
973830278 4:54752488-54752510 CTGCTGCTGTTGGGAAAGACGGG - Intergenic
975132466 4:70842723-70842745 CTGCTGCTATTAAGAAAATGAGG - Intergenic
975498811 4:75062484-75062506 CAGCTGCTGCTGAGCAATATAGG - Intergenic
976496988 4:85741283-85741305 CTTTTGCTGTTAGGAAAAATGGG + Intronic
976791605 4:88885120-88885142 CTGGTTCTGTTAAGAACAATTGG - Intronic
977799422 4:101208350-101208372 CTGTGGTTGTTGAGAACAATGGG - Intronic
978521740 4:109623012-109623034 CTGCTTCTGGTGAGAAGAAGAGG + Intronic
978717531 4:111864107-111864129 CAGCTGCTGTAGGGGAAAATGGG + Intergenic
978726696 4:111977632-111977654 CTGCAGCTGTTGTGAGGAATGGG + Intergenic
979124524 4:116950961-116950983 CTGCTGCTGTTTCCAAAAATTGG - Intergenic
980936480 4:139230576-139230598 ATGCTGCTGTGGAGGAAACTGGG + Intergenic
981728892 4:147876714-147876736 CTGTTGCCTTTGAGAGAAATTGG + Intronic
982258012 4:153468130-153468152 TTGCGGCTGTTTAGAAAAACAGG + Intronic
984278161 4:177635069-177635091 CTGCTGCTATTGATATAAAGAGG - Intergenic
984435936 4:179710153-179710175 CTGCTGCTGTTGAGATGAAGTGG + Intergenic
985031877 4:185797513-185797535 CTGATGCTGATGACAAAAATAGG + Intronic
986048677 5:4066164-4066186 CAGCTACTGATGAGAAAAAATGG + Intergenic
986936876 5:12900069-12900091 CTGGAGCTGTGGAGAAAGATAGG + Intergenic
989111169 5:37907763-37907785 CTGCTGCCCTTGAGAAAATGTGG - Intergenic
990475264 5:56156453-56156475 CTCCTGGGGTGGAGAAAAATAGG + Intronic
991483664 5:67111707-67111729 CTGCTGTTGTCCAGAAAAACAGG - Intronic
993954084 5:94211396-94211418 CTTCTGGTGTTTAGAAACATAGG + Intronic
994110863 5:96002567-96002589 CTTCTGCTGTTCATAAAGATTGG - Intergenic
994322579 5:98410391-98410413 CTGCTGTTAGTGAGATAAATGGG + Intergenic
994909118 5:105879062-105879084 CTGCTGCTAATGAAAAACATTGG - Intergenic
995242452 5:109900517-109900539 CTGCTTCTGGTGAGAAGAAGAGG - Intergenic
996941019 5:129005557-129005579 TGGCTGCTTTTGAGAAACATGGG - Intronic
999863387 5:155673806-155673828 GTGCTGTTGTGGAGAAGAATTGG + Intergenic
1000332350 5:160215798-160215820 CAGCTGCTGTTGTGAGGAATGGG + Intronic
1001822700 5:174722243-174722265 CTGCTGAGGTGGAGACAAATCGG - Intergenic
1002682233 5:180975594-180975616 CTGCTGCTGTTGAGCCACTTTGG + Intergenic
1003410126 6:5854782-5854804 CTGCTGCTGTTTTGTATAATTGG - Intergenic
1003558478 6:7161591-7161613 CAGCTGGTTTTGAGAAAGATAGG - Intronic
1004170646 6:13293146-13293168 CTGCTGCTTTTTAGAAAACCTGG - Intronic
1004392798 6:15223422-15223444 CTGTTCCTGTTGAGAGAAACAGG - Intergenic
1004494673 6:16152568-16152590 TTGCTGCTGTTGAGAAACCCTGG + Intergenic
1005268756 6:24140904-24140926 CTGCTGCTGGAAAGGAAAATTGG - Intronic
1005912341 6:30322103-30322125 ATGCTGGTGTGGATAAAAATAGG + Intergenic
1007688918 6:43685362-43685384 CTGCTGCTGTTGAGAAAGCCTGG - Intronic
1009038672 6:58150625-58150647 CTGCTTGTGTTGAGAACAGTTGG + Intergenic
1009977421 6:70686518-70686540 CTGATACAGTTGACAAAAATTGG + Intronic
1010890822 6:81308434-81308456 CTGCTGCAGTTTAGAGAAAAGGG - Intergenic
1011262695 6:85485402-85485424 ATGCTGCTGTTTAGAAGAATGGG - Exonic
1011484429 6:87827639-87827661 CTTCTCCTGCAGAGAAAAATGGG - Intergenic
1014193501 6:118525111-118525133 CTACTGTTGTAGAAAAAAATTGG - Intronic
1014288590 6:119531941-119531963 CTGCTGCTGTTGCTAAAGAGAGG - Intergenic
1015002900 6:128241575-128241597 ATGCTGCTTTTGGGAAATATAGG + Intronic
1018228789 6:161655744-161655766 CTCCTGCTGCTGAGAGAAATTGG + Intronic
1018345629 6:162896255-162896277 CTCCTGCTGTTTAGAGGAATTGG + Intronic
1019052366 6:169192898-169192920 CTGCTGCTGAGGAGAGAATTGGG - Intergenic
1020442930 7:8238218-8238240 CAGCTGCTGTGGAAAACAATAGG - Intronic
1022771688 7:33480252-33480274 CTGCTGCTGTTGTTAACACTGGG - Intronic
1026664998 7:72334576-72334598 CTGCTTCTGTTGAGAAACGATGG - Intronic
1028291569 7:89071979-89072001 TTGCTGCAGGTGATAAAAATGGG + Intronic
1028315846 7:89401644-89401666 CTAATGCTGTGGAAAAAAATAGG + Intergenic
1028619951 7:92814361-92814383 CAGCTGCTCTGGAGAAATATTGG - Intronic
1030351940 7:108499518-108499540 GTTCTGCTGTTGAGAAAACTTGG - Intronic
1030877316 7:114831226-114831248 CTGTTCTTGTTGGGAAAAATTGG + Intergenic
1031845619 7:126802710-126802732 CTGCAGCTCTTAAGGAAAATAGG - Intronic
1031850840 7:126860660-126860682 CTGCCGCTGTTTAAAAGAATTGG - Intronic
1032024241 7:128428963-128428985 CTGCTGCTGTTAAGAACCAATGG - Intergenic
1035764364 8:2093909-2093931 CTGCTGCAGGAGAGAAAAAGTGG + Intronic
1036144078 8:6236758-6236780 CCATTCCTGTTGAGAAAAATGGG + Intergenic
1037168160 8:15856555-15856577 CTGCTGCTTTGGAGAAAATATGG + Intergenic
1037191388 8:16130042-16130064 CTTTTGCTGCTGTGAAAAATGGG + Intronic
1038134123 8:24767410-24767432 CTGCTGCTGTTGGGAAACAGGGG - Intergenic
1038646221 8:29364834-29364856 CTGCTGCTGTGGAGAAGGTTTGG - Intergenic
1041227764 8:55717163-55717185 CTGCAGCTGCTGTGAAGAATAGG - Intronic
1043297306 8:78682317-78682339 CTACTGCTATTAAGAAATATCGG + Intronic
1044061545 8:87642813-87642835 AAGCTGCGGTTGATAAAAATGGG - Intergenic
1044517118 8:93152432-93152454 GTGCTTCTGTTAAGGAAAATTGG + Intronic
1046501298 8:115080900-115080922 CTGCTGATAATCAGAAAAATTGG + Intergenic
1046793632 8:118347389-118347411 CTGCTGGTGTCTAGAAAACTTGG - Intronic
1047349810 8:124062917-124062939 CTGCTGAAGAGGAGAAAAATGGG - Intronic
1047523076 8:125610407-125610429 GTGCTTCTGTTGATAAAATTTGG + Intergenic
1047890428 8:129302917-129302939 CTGCTGCTGCTGTGGAAGATGGG + Intergenic
1047918512 8:129608532-129608554 GTAGTGCTGTTGAGAAAACTTGG - Intergenic
1050222971 9:3416601-3416623 CTGGTGCTGTTGAGAATCACTGG + Intronic
1050649720 9:7762870-7762892 CAGATGCTATTGAAAAAAATGGG - Intergenic
1052565123 9:30140060-30140082 CTGCAACTGGAGAGAAAAATGGG - Intergenic
1053503878 9:38623118-38623140 GTGTTGCTGGGGAGAAAAATGGG + Intergenic
1056429990 9:86517661-86517683 CTGGTGCTCTTGTAAAAAATTGG + Intergenic
1057301320 9:93886351-93886373 CTGCTCATGTTGAGATAATTAGG + Intergenic
1057444799 9:95106040-95106062 CAGCTACTGTGGAGAAGAATGGG - Intronic
1057865755 9:98679366-98679388 TTGCTGGTGTGGAGAAAACTTGG - Intronic
1059003815 9:110379672-110379694 CTGCTGCTGTTGAGAAAAATTGG + Intronic
1060002342 9:119969837-119969859 CTTCTGCTGTTGAGGACAGTGGG - Intergenic
1188294099 X:28424871-28424893 GTGCTGTTGTGGAGAAGAATTGG - Intergenic
1189371806 X:40434741-40434763 AGGCTGCTGTAGAGCAAAATTGG + Intergenic
1191129243 X:56990674-56990696 ATTCTACTTTTGAGAAAAATTGG + Intronic
1194126755 X:90028013-90028035 CTACTGCTGATGAGAAAATTAGG + Intergenic
1195806000 X:108766184-108766206 CAGCTGCTGTAAAAAAAAATTGG - Intergenic
1197572157 X:128163152-128163174 CTGCAGCTGTTGTGGGAAATGGG + Intergenic
1197857435 X:130931258-130931280 ATGTTACTGTTGAGAAAAACTGG + Intergenic