ID: 1059004292

View in Genome Browser
Species Human (GRCh38)
Location 9:110384274-110384296
Sequence GGAGCTCTGCTTGCCCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059004291_1059004292 -7 Left 1059004291 9:110384258-110384280 CCTTTGGCTGGGGGTGGGAGCTC 0: 17
1: 54
2: 154
3: 734
4: 1502
Right 1059004292 9:110384274-110384296 GGAGCTCTGCTTGCCCCATGTGG No data
1059004281_1059004292 25 Left 1059004281 9:110384226-110384248 CCTGAGTGGGGTAGCACAATCAC 0: 1
1: 6
2: 29
3: 159
4: 680
Right 1059004292 9:110384274-110384296 GGAGCTCTGCTTGCCCCATGTGG No data
1059004287_1059004292 -1 Left 1059004287 9:110384252-110384274 CCACCTCCTTTGGCTGGGGGTGG 0: 1
1: 23
2: 86
3: 162
4: 489
Right 1059004292 9:110384274-110384296 GGAGCTCTGCTTGCCCCATGTGG No data
1059004290_1059004292 -4 Left 1059004290 9:110384255-110384277 CCTCCTTTGGCTGGGGGTGGGAG 0: 2
1: 26
2: 77
3: 142
4: 529
Right 1059004292 9:110384274-110384296 GGAGCTCTGCTTGCCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059004292 Original CRISPR GGAGCTCTGCTTGCCCCATG TGG Intronic
No off target data available for this crispr