ID: 1059010101

View in Genome Browser
Species Human (GRCh38)
Location 9:110448563-110448585
Sequence GTTGTAATGACACCAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059010101 Original CRISPR GTTGTAATGACACCAAACAC AGG (reversed) Intronic
901507033 1:9691247-9691269 GTGGTACTGAAACCAACCACAGG - Intronic
910009415 1:82442589-82442611 CCTGTAAAGACACCAAACAATGG - Intergenic
912330062 1:108811872-108811894 AGTGTGATGACAGCAAACACTGG + Intergenic
913471059 1:119186882-119186904 GTTGTAATAACAATAAACATGGG + Intergenic
915101863 1:153506773-153506795 GCAGGAATGACACCAAAGACCGG + Intergenic
915792086 1:158683560-158683582 TATGTAAAGCCACCAAACACAGG + Intronic
918727532 1:187944422-187944444 GTTGCAATTACAACAAACAGTGG - Intergenic
919716887 1:200787593-200787615 GTTGAAATGACAACAAACAATGG + Intronic
920065813 1:203268906-203268928 GTATGAAGGACACCAAACACAGG - Intronic
1074213814 10:111364495-111364517 TATGAAATGACACCAAACCCGGG - Intergenic
1074629333 10:115233146-115233168 CTTGTAAGGACACCAGTCACTGG + Intronic
1074703899 10:116114948-116114970 GTTCTTATGACACCAGCCACTGG - Intronic
1076051040 10:127333361-127333383 GTTTTATTGGCAGCAAACACTGG + Intronic
1079600616 11:22308561-22308583 ATAGTAATAACACCAAACACTGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1082647067 11:55740166-55740188 GCTGTAATGAAACCACACATTGG + Intergenic
1085231567 11:74975927-74975949 GGTTTAATGACACCAATTACTGG - Intronic
1085293264 11:75415359-75415381 GTTATAATGTCTCCAAACAGAGG - Intronic
1087807720 11:102573421-102573443 ATTGGAATGAGACCAAAGACAGG + Intergenic
1091046810 11:132332608-132332630 GTAGCAAGGAGACCAAACACAGG + Intronic
1093212410 12:16323878-16323900 GTGATACTGACACCAAACACTGG + Intergenic
1097703943 12:62848677-62848699 GTTTTAATTTCACCAAGCACTGG + Intronic
1097892360 12:64790832-64790854 GTTTTAGTGCCACCAAACTCAGG - Intronic
1102806973 12:115790745-115790767 GTTTACATGACATCAAACACTGG + Intergenic
1104587300 12:130057623-130057645 TTTATAAAGACACCAATCACTGG - Intergenic
1107859520 13:44647634-44647656 CTTGTCATGACACCCAACAGAGG + Intergenic
1108405959 13:50102227-50102249 GTATTAATGAAACCAAACCCTGG + Intronic
1111216199 13:85144966-85144988 TTTATTATGACACCAAAAACAGG - Intergenic
1111360954 13:87175559-87175581 TTTGTAAGGACACCAATCATTGG + Intergenic
1113350786 13:109527100-109527122 GTTGTAATGACCACAATTACAGG + Intergenic
1117949859 14:61071809-61071831 GTTGTAATTAACCCAAAGACAGG + Intronic
1121649239 14:95545003-95545025 CTTATAAAGACACCAGACACTGG - Intergenic
1125240059 15:37564218-37564240 GTAGTGACAACACCAAACACTGG + Intergenic
1126527310 15:49670674-49670696 TTTGTAATTACACCACAGACTGG - Intergenic
1127701797 15:61508415-61508437 TTCTTAATGACACAAAACACAGG - Intergenic
1130756272 15:86767315-86767337 TTTATAATGACACCAGACAAAGG - Intronic
1131935057 15:97494554-97494576 CTTTTGATGACACTAAACACTGG - Intergenic
1144389671 17:14781439-14781461 ATTGTCATGACACCAACCCCTGG + Intergenic
1145752470 17:27365143-27365165 GTTATAAGGACACTAATCACTGG - Intergenic
1149218194 17:54383920-54383942 ATTGTAAAGACAACAAAAACTGG - Intergenic
1149354944 17:55829991-55830013 GTTTTTATGACACCAAATAGCGG + Intronic
1151675042 17:75592898-75592920 GTGGTAATGACGCCAAATGCTGG + Intergenic
1151975382 17:77481184-77481206 GCTGTTAAGACACCACACACGGG - Intronic
1153539770 18:6140906-6140928 GTTTTAATATCACCACACACTGG + Intronic
1155645191 18:28069450-28069472 GTTGGAATGAAACAAAACATGGG - Intronic
1156999373 18:43506407-43506429 GTTGTCATGATACCAAAATCTGG - Intergenic
1158800523 18:60903098-60903120 GGTGTAATGAGCCCAAACATAGG + Intergenic
1160389266 18:78518016-78518038 CTTATAAGGACACCAGACACTGG - Intergenic
1164583380 19:29449220-29449242 GAAGTAATGACACCAACCACTGG + Intergenic
928070146 2:28206853-28206875 GTTGTAATGGTACTAAACACTGG - Intronic
931985343 2:67736394-67736416 CTTATAAGGACACCAAATACAGG + Intergenic
942211337 2:173673914-173673936 TTTGCAATGCCACTAAACACTGG + Intergenic
948949903 2:241242673-241242695 GTTGGCCTGAAACCAAACACAGG + Exonic
1169398488 20:5258609-5258631 ATAGTGATGACACCAAATACTGG + Intergenic
1169696204 20:8389561-8389583 GTTGAAATTACACCAGACAGGGG - Intronic
1179572283 21:42284788-42284810 GTCTTCATGACACCAAACCCTGG + Intronic
955835493 3:63050004-63050026 TTTGTAATGACACCAAGTACAGG - Intergenic
959958125 3:112263229-112263251 GTTGACATGACACCAAAGAAAGG + Intronic
960531030 3:118764990-118765012 TCTATAATGACACCAGACACTGG + Intergenic
963959699 3:151295509-151295531 TTTGTAATGATATCAAACATGGG - Intronic
964900853 3:161657177-161657199 GATGTGATGACTCCAAAGACAGG + Intergenic
967280794 3:187821744-187821766 GTGGTCAAGACACCAAACAGTGG - Intergenic
967393473 3:188980264-188980286 ATGGAAATGACACCAAGCACAGG + Intronic
969245396 4:5928868-5928890 GTTGAAAGCACACAAAACACTGG - Intronic
975075086 4:70196972-70196994 GTTCTAATAACACCTCACACAGG + Intronic
979466897 4:121049885-121049907 TTTGTATGGACCCCAAACACAGG + Intronic
980689221 4:136271610-136271632 GTTGTAATGTCTGGAAACACTGG + Intergenic
983007972 4:162508722-162508744 TTTGTAAGGACTCTAAACACTGG - Intergenic
984455050 4:179955498-179955520 TTTGTATTGACAGAAAACACAGG - Intergenic
985107929 4:186516700-186516722 GTTGCAATGACATCACACAAAGG - Intronic
985386910 4:189457169-189457191 GTGGTAATGCCACCAATCTCAGG - Intergenic
986167425 5:5287388-5287410 GTTGAAATGACAGCAGACTCAGG - Intronic
987624377 5:20378657-20378679 GTATTAATGATGCCAAACACCGG + Intronic
989630487 5:43477286-43477308 GTTAAAATGACACCAGACACAGG + Intronic
993641668 5:90413276-90413298 GATGTAAAGAGACAAAACACTGG - Intergenic
994991483 5:107002183-107002205 GTTGTAATGAAGCCTAACATTGG - Intergenic
995223750 5:109680543-109680565 ATTGTAGTGACAGCAAACAAAGG + Intergenic
995311452 5:110716856-110716878 GTTTTAAGGACACTAAGCACTGG + Intronic
1008086714 6:47253224-47253246 GTGGTAATGACACACAACAAGGG + Intronic
1009217029 6:60934537-60934559 ATTGTAATGACCCCAAAGTCTGG + Intergenic
1010960389 6:82139002-82139024 GTTGTAAAGACAACAGAGACTGG + Intergenic
1011767841 6:90643086-90643108 GTGGGAATGACACCAAAAGCCGG - Intergenic
1012256731 6:97041288-97041310 GTTGCAATAACAACACACACAGG - Intronic
1015398710 6:132764157-132764179 GTGGTTATGTCACCAAACCCTGG - Intergenic
1016452536 6:144198036-144198058 GTTTTTATGCTACCAAACACTGG - Intergenic
1020506127 7:8990926-8990948 TTAGTAATGACACCAAATGCTGG + Intergenic
1020660478 7:10974784-10974806 TTCATAATCACACCAAACACAGG - Intronic
1021364154 7:19755614-19755636 CTTGTAGTGACACCAGAAACAGG - Intronic
1028983951 7:96995749-96995771 ATTCTAATGACCCCAAACATGGG - Intergenic
1029693761 7:102199912-102199934 GTTGCACTCACAGCAAACACAGG + Intronic
1033766437 7:144497210-144497232 GTTTTAGTGACACTAAACAGAGG + Intronic
1035477751 7:159155632-159155654 GTTGTCATGGCACCTCACACTGG - Intergenic
1038218090 8:25581453-25581475 GTTGTATTTTCACCAAATACGGG + Intergenic
1039163909 8:34654821-34654843 ATTTTAATTACTCCAAACACTGG + Intergenic
1040832504 8:51693322-51693344 AATGTAATGACAGCATACACTGG - Intronic
1043510049 8:80941476-80941498 GTTCTACTGACACCCACCACAGG - Intergenic
1047690906 8:127353620-127353642 GGTGTAATGATAACAAACAGAGG + Intergenic
1059010101 9:110448563-110448585 GTTGTAATGACACCAAACACAGG - Intronic
1185849047 X:3468337-3468359 GATGTGATGGCACCAAACAAAGG - Intergenic
1185895651 X:3856275-3856297 GTTGTAATTACACATAACTCAGG - Intergenic
1185900770 X:3894699-3894721 GTTGTAATTACACATAACTCAGG - Intergenic
1187990989 X:24872097-24872119 GTTGTAATTAGACCAAAAAAAGG + Intronic
1189173139 X:38928757-38928779 GGTGAAATGACACCAAAAAGTGG - Intergenic
1189248978 X:39585356-39585378 GTGGGAATAACACCACACACAGG + Intergenic
1196136346 X:112213507-112213529 GTTTGTATGACACCAAGCACTGG - Intergenic
1196603083 X:117623578-117623600 GTTGTAAAGGCAACAAACAAGGG - Intergenic
1199241356 X:145551370-145551392 CTTATAAGGACACCAATCACTGG - Intergenic
1199576028 X:149314913-149314935 GTTTTCATGTCACCAAACAAAGG - Intergenic