ID: 1059010144

View in Genome Browser
Species Human (GRCh38)
Location 9:110449030-110449052
Sequence TATTGTCCTCAAGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059010144 Original CRISPR TATTGTCCTCAAGATGCTGC TGG (reversed) Intronic
907739535 1:57151327-57151349 TAAGGTCCTCCAGATGCTGCAGG + Intronic
908825611 1:68130157-68130179 AATTGTCATTAAAATGCTGCCGG - Intronic
912096232 1:106148255-106148277 TTTTGTCCTCATGATTCTGTAGG - Intergenic
912386283 1:109272718-109272740 TTCTGTCCTCACCATGCTGCTGG - Exonic
913551866 1:119924192-119924214 CATTGTACTCACTATGCTGCAGG + Intronic
916585267 1:166144550-166144572 TGTTGTCCTCATGATGGAGCAGG + Intronic
917367143 1:174244608-174244630 CATTGACCTCAAGATACTTCTGG - Intronic
918014009 1:180615278-180615300 TATTATCCTCAAAAGGCTTCCGG - Intergenic
923064370 1:230504477-230504499 TTGTGTCCTCAGCATGCTGCTGG + Intergenic
923261171 1:232269389-232269411 TACTGTCCTGGAGATGATGCTGG + Intergenic
924905970 1:248453028-248453050 CACTGTCCCCAAGATGCTCCAGG + Exonic
924921919 1:248639006-248639028 CACTGTCCCCAAGATGCTCCAGG - Exonic
1063059634 10:2537946-2537968 TATTGTCCTGGAGACGCGGCAGG - Intergenic
1064363763 10:14689095-14689117 CCTTGTCCTCAAGAAGCTCCTGG + Intronic
1065171984 10:23040222-23040244 TCTTGTATTCCAGATGCTGCAGG - Intergenic
1066446648 10:35490201-35490223 TATTTTCCTCAGAATGCTACAGG + Intronic
1067514808 10:46929655-46929677 TTCTGTCCTCAAGATGCTTATGG + Intronic
1067647448 10:48122159-48122181 TTCTGTCCTCAAGATGCTTATGG - Intergenic
1068475607 10:57520508-57520530 CATTATCCTCTAGATGCTGGCGG + Intergenic
1070564939 10:77596615-77596637 CATTATCCTTAAGATGCTACGGG + Intronic
1072257448 10:93633583-93633605 TCTTGCCCTCAAGATGCTTAGGG - Intronic
1074003682 10:109397119-109397141 TTTTGGCATCAGGATGCTGCTGG - Intergenic
1074281494 10:112055889-112055911 TGTTGACCTCAAGTTTCTGCAGG - Intergenic
1075014361 10:118899384-118899406 GCCTGTCCTCAAGATGCTACAGG + Intergenic
1076667638 10:132102228-132102250 TTTTGTCCTCAGGATGGAGCTGG + Intergenic
1077658647 11:4046520-4046542 TAATGTCCTCAAGAAGATGCTGG - Intronic
1080188006 11:29513896-29513918 TACTGTCATCCAGATTCTGCAGG + Intergenic
1080615657 11:33942742-33942764 TGTGGTCCTCCAGATGCTGTTGG + Intergenic
1085340091 11:75725737-75725759 TCCTGTCATCAAGATGCAGCTGG - Intronic
1086751306 11:90497288-90497310 TTTTGGCATCAAGATGATGCTGG + Intergenic
1087167631 11:95020941-95020963 GCCTGTCCTCAAGATGCTACAGG - Intergenic
1087605185 11:100368689-100368711 TATTTTCCACAAAATGCTGGAGG + Intergenic
1090553064 11:127843859-127843881 TAATGTCTTCAAAATCCTGCGGG + Intergenic
1091112675 11:132984748-132984770 TAGTGTCTTCAAGCTGTTGCTGG - Intronic
1094732672 12:33196368-33196390 TTTTGTTATCAAGATGATGCTGG + Intergenic
1095806307 12:46324276-46324298 GCCTGTCCTCAAGATGCTACAGG - Intergenic
1100453575 12:94730803-94730825 TATTTGCCTCATGATTCTGCAGG + Intergenic
1100700512 12:97142832-97142854 TATTGGCTCCAAGGTGCTGCAGG + Intergenic
1101281989 12:103267270-103267292 CATTGGCCTCAAGTTGCTGAGGG + Intronic
1102332676 12:112048096-112048118 TAATGGTCTCAAGATGTTGCTGG + Intronic
1102604973 12:114061363-114061385 GCCTGTCCTCAAGATGCTACAGG + Intergenic
1104968015 12:132518134-132518156 TAGTGTCCCCAAGAGCCTGCTGG + Intronic
1105348502 13:19595765-19595787 TATTGTTCTCAAGAGGCCACAGG + Intergenic
1105771436 13:23616142-23616164 TATTAACCTGAAGATGCTGGTGG + Intronic
1106470066 13:30046426-30046448 TGTTGTCTTTAAGATGCTGTGGG + Intergenic
1106591730 13:31104231-31104253 TTTTGTCTTCAAAGTGCTGCAGG - Intergenic
1107077185 13:36335289-36335311 TATACTCCTCAAGCTGCTGAAGG - Exonic
1107309178 13:39058548-39058570 TTTTGGCATCAAGATGATGCTGG + Intergenic
1109811512 13:67519206-67519228 TATTTTTCTCATGATTCTGCTGG - Intergenic
1110175356 13:72549327-72549349 TATTGACCTCAAGAGGCATCTGG + Intergenic
1111167271 13:84476155-84476177 TTTTGTTATCAAGATGATGCTGG + Intergenic
1113351567 13:109534525-109534547 TTTTATCCTCAAGATTCTTCTGG + Intergenic
1113528975 13:111006025-111006047 TGTTGGCCTGAGGATGCTGCAGG + Intergenic
1117920993 14:60724671-60724693 TTTTGTCATCTAGATGCTGAGGG - Intergenic
1118487835 14:66230645-66230667 CATTGCCCTCAATATACTGCAGG - Intergenic
1118971784 14:70643059-70643081 CATTTTGCTCAAGATGCTGAAGG - Intronic
1119722863 14:76902969-76902991 AATAGTCCCCAAGAAGCTGCAGG + Intergenic
1123023433 14:105412610-105412632 TAGTGTCCCCAAAATGCAGCTGG - Exonic
1124688610 15:31803406-31803428 TATTGTCCCCAAGACACTGATGG + Intronic
1126678438 15:51181997-51182019 GATTGTGCTCAAGATGTTACTGG + Intergenic
1128721957 15:69956637-69956659 TGCTGACCTCAAGCTGCTGCTGG + Intergenic
1137707310 16:50544568-50544590 TATTGACCACAACATGCTCCTGG + Intergenic
1140820358 16:78657410-78657432 TATTGTTCTTGACATGCTGCAGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148882577 17:50741642-50741664 TATTGTCTTCAATAGGCCGCTGG + Exonic
1149320120 17:55473704-55473726 GCCTGTCCTCAAGGTGCTGCAGG + Intergenic
1149590147 17:57823027-57823049 TATTATCCCCAAGGTGCTGATGG + Intergenic
1150629616 17:66870140-66870162 TATTGTGCTCATGATTTTGCGGG + Intronic
1151555299 17:74843442-74843464 CAGCGTGCTCAAGATGCTGCAGG - Exonic
1153726740 18:7964488-7964510 CATTGTCTTCATAATGCTGCTGG + Intronic
1155183783 18:23370296-23370318 TATTCTGCTCAAGGAGCTGCTGG + Intronic
1156526275 18:37770298-37770320 TATTAGCAGCAAGATGCTGCTGG + Intergenic
1156916245 18:42466781-42466803 GCCTGTCCTCAAGATGCTACAGG + Intergenic
1158728952 18:60002035-60002057 TCCTGTCATCACGATGCTGCTGG + Intergenic
1159283319 18:66315503-66315525 TATTTTCCTTCAGATGCTGTTGG - Intergenic
1160669475 19:352562-352584 TATTGTCTTCCAGAGGCTGGAGG + Intergenic
1162590076 19:11585720-11585742 CATGGTCGTGAAGATGCTGCTGG - Intronic
1165731874 19:38151135-38151157 CTTTGCCCTCCAGATGCTGCTGG - Intronic
1167045627 19:47047237-47047259 GATTGTCCTCCACATTCTGCAGG - Intronic
1167367222 19:49061158-49061180 TATTACCCTCAAGTTGCTCCAGG + Exonic
1167816759 19:51889170-51889192 GATTGTCTTCTAGATGCTACTGG - Intronic
927842306 2:26453499-26453521 TGATGTCCTCAAGATTCTGGAGG + Exonic
931003213 2:57814216-57814238 TATTTTCATAAAAATGCTGCTGG - Intergenic
933223513 2:79718004-79718026 TATGGTCTTCAAGAGGTTGCAGG - Intronic
935317778 2:101854032-101854054 TCTCTTCCTCAAGAAGCTGCTGG + Intronic
936557857 2:113511691-113511713 TATTGTTCTCATGATCCTGGAGG + Intergenic
937451641 2:122007156-122007178 TCTTGGCATCAAGGTGCTGCTGG + Intergenic
937985350 2:127635832-127635854 TAGTGTCCCCAAGATCCTGAGGG + Exonic
939845924 2:147246044-147246066 TATTCTCCTCATTATCCTGCAGG - Intergenic
940326610 2:152432422-152432444 TATTGTTCTAAAGATGCACCAGG + Intronic
941681956 2:168409516-168409538 TATTGGTATCAAGATGATGCTGG + Intergenic
942926869 2:181444202-181444224 TATTTTCCCCAAAATTCTGCTGG + Intergenic
944445390 2:199783700-199783722 TTGTGTCCTGAAGGTGCTGCTGG - Intronic
944540406 2:200748728-200748750 TACTGTCCTCATGATGATGGGGG - Intergenic
1169302194 20:4452727-4452749 AAATGTCCTCAGGATACTGCTGG - Intergenic
1173176712 20:40770519-40770541 TATTATCATCAAGAAGCTCCTGG - Intergenic
1173482385 20:43413010-43413032 GTTTGTCCTCAGGATTCTGCTGG - Intergenic
1173793167 20:45841118-45841140 TCTTGTCCCCAAGCAGCTGCAGG - Exonic
1176944766 21:14966041-14966063 TACTGTCCTCCAGTTGCTCCTGG - Exonic
1183850841 22:40586486-40586508 TATTTTCCTGAAGATTCTGAGGG - Intronic
1184703280 22:46192243-46192265 AATTGGGCCCAAGATGCTGCAGG + Intronic
951779688 3:26348181-26348203 AATTCTCCTCAAGAGGCTGAAGG + Intergenic
952257297 3:31706408-31706430 TTTGGTCCTCAAGAGGCTGGAGG - Intronic
953188735 3:40663589-40663611 TAGTGTCGTCAAGGTGCTGCTGG - Intergenic
954360070 3:50117292-50117314 CATTGGCAACAAGATGCTGCAGG + Exonic
955220731 3:57020925-57020947 TATTATCTGCAAAATGCTGCTGG - Intronic
956551883 3:70470353-70470375 TATTTTACTCAAGATGCTGTAGG - Intergenic
958689656 3:97447613-97447635 GATTGTCCACAATATGCTGGTGG - Intronic
959002977 3:100986168-100986190 TATTGGCCTGAGGTTGCTGCAGG - Intronic
961101586 3:124203488-124203510 TATTGTCCTCAGGGGACTGCTGG + Intronic
963204601 3:142619619-142619641 TACTATCTCCAAGATGCTGCAGG - Intronic
965132406 3:164718129-164718151 TATTTTCCTCAGGCTGCTGGTGG + Intergenic
965335578 3:167428131-167428153 GCTTGTCCTCAAGGTGCTACAGG + Intergenic
966595816 3:181724012-181724034 TAGGGTCGTGAAGATGCTGCGGG + Intergenic
967512027 3:190323147-190323169 TATTGTCCTTATGAAACTGCAGG + Intronic
968292851 3:197552376-197552398 TATGTTCCGCAAGATCCTGCAGG - Intronic
968412561 4:402638-402660 AACTGTCCTCGAGATGCTACCGG - Intergenic
969977328 4:11116830-11116852 CATTGTCATGATGATGCTGCAGG - Intergenic
971200475 4:24505615-24505637 GATTGTCCTCAGAATGCTACAGG + Intergenic
971478864 4:27096656-27096678 TATTGTCACCAAGTTGCTGGGGG - Intergenic
971743198 4:30546305-30546327 TGTTGTCATCAAGATTCTGTGGG - Intergenic
972878289 4:43393162-43393184 TATTTGGCTCAAGATTCTGCTGG + Intergenic
973660397 4:53099486-53099508 TATTTTGCTCAAGGTTCTGCAGG + Intronic
977448157 4:97158309-97158331 TATTGTCCTCTACAGGGTGCAGG - Intergenic
978025285 4:103865931-103865953 TTTTGTTGTCAAGATGATGCTGG + Intergenic
979581712 4:122368430-122368452 TTTTGGCATCAAGATGATGCCGG - Intergenic
983818143 4:172158074-172158096 AATTGACCTCAATATGCTGTTGG + Intronic
986284774 5:6351129-6351151 TATTGCCCTCAAGATGAAGGGGG - Intergenic
986328797 5:6702513-6702535 ATTTGCCCTCAAGATTCTGCTGG - Intergenic
986334792 5:6746112-6746134 TATTGCCTTGAAGAGGCTGCTGG + Intronic
986556898 5:9019161-9019183 TATTTAGCTCAAGATTCTGCAGG + Intergenic
987530907 5:19118145-19118167 TTTTGTTATCAAGATGATGCTGG - Intergenic
988128780 5:27076748-27076770 TTTTGTTATCAAGATGATGCTGG - Intronic
996484365 5:124013983-124014005 GGTTGTCCTCAAGATGCTTAAGG - Intergenic
996691540 5:126345726-126345748 CATTGTCCTCAGGATACTCCAGG + Intergenic
996957627 5:129203391-129203413 TAATGTGCCCAATATGCTGCTGG + Intergenic
998442062 5:142170940-142170962 TGTTGTCCTCAAGGTGCCTCGGG - Intergenic
1000382093 5:160638432-160638454 CTGTGTCCCCAAGATGCTGCAGG - Intronic
1002090782 5:176804626-176804648 TATCTTCCCCAACATGCTGCAGG + Intergenic
1003987260 6:11449227-11449249 TATTGTCCTAGAGATTGTGCTGG - Intergenic
1004227724 6:13802242-13802264 TATGGTCACCAAGATGCAGCAGG - Exonic
1006244728 6:32721360-32721382 TATTGTCCTCATGATTCTCTAGG + Intergenic
1009488101 6:64251141-64251163 TATTGTCCTGAGGATACTGCTGG - Intronic
1009961760 6:70531341-70531363 TTTTGTCTTCAAGATGATACTGG + Intronic
1010136011 6:72553905-72553927 TATTGTAAACAAGAAGCTGCTGG - Intergenic
1010756812 6:79674752-79674774 GATTCTCCTCAGGATGCTACAGG - Intronic
1010761611 6:79729911-79729933 TAATGTCTTCAAAATGCTGCGGG + Intergenic
1010983875 6:82400197-82400219 TAATGTCCTCAAGATCATCCAGG - Intergenic
1011627133 6:89291776-89291798 TATTGTTCTCAAGAAGCTGATGG - Intronic
1012207461 6:96478683-96478705 TTTTCCCCTCAAAATGCTGCTGG - Intergenic
1012740160 6:103006525-103006547 TTTGGTCCTCAGGATGATGCTGG - Intergenic
1013768136 6:113597010-113597032 AAGTGTCCCCATGATGCTGCTGG + Intergenic
1015381578 6:132576038-132576060 AATTGTCCTCAACATAGTGCAGG + Intergenic
1017639376 6:156476285-156476307 TAATGTCTTCAATATGCTGAGGG + Intergenic
1017922402 6:158883740-158883762 GCCTGTCCTCAAGATGCTACAGG - Intronic
1019196014 6:170283598-170283620 CCTTGTCCTCATGCTGCTGCTGG - Exonic
1021411518 7:20334003-20334025 TATTGCCCTCAACATTCTCCTGG - Intronic
1022441456 7:30436607-30436629 CCTTGTCCTCAGGATGATGCTGG - Intronic
1027583206 7:80023723-80023745 TTTTGTCATCAGGATGATGCTGG - Intergenic
1028406915 7:90485275-90485297 TATTTTCCTAAAAATGCTCCTGG + Intronic
1030193963 7:106835206-106835228 GCTTGTCCTCTAGATGCTACAGG + Intergenic
1030215117 7:107036700-107036722 TAATATCCTCAAAATGCTGAGGG - Intergenic
1034853869 7:154522278-154522300 TCTTATTCTCAAGATCCTGCAGG + Intronic
1041617607 8:59926417-59926439 TATGTTCCTCAAAGTGCTGCTGG + Intergenic
1042753841 8:72187837-72187859 TTTTGTTATCAAGATGATGCTGG - Intergenic
1049894970 9:104496-104518 TATTGTTCTCATGATCCTGGAGG - Intergenic
1050808146 9:9708982-9709004 TATTGTCCTCAAGAAGCTCATGG - Intronic
1051089586 9:13390614-13390636 TTTTGGTCTCAGGATGCTGCTGG - Intergenic
1052094919 9:24372193-24372215 TAATGTCCTCCAGTTGTTGCAGG - Intergenic
1053737361 9:41109558-41109580 TATTGTTCTCATGATCCTGGAGG - Intergenic
1054690988 9:68321761-68321783 TATTGTTCTCATGATCCTGGAGG + Intergenic
1056214976 9:84398131-84398153 TTATTTCCTCAAGATGTTGCTGG + Intergenic
1057512379 9:95691547-95691569 TATTGTCCACACCATACTGCAGG - Intergenic
1058408804 9:104707111-104707133 TATTGGCATCAGGATGATGCTGG - Intergenic
1059010144 9:110449030-110449052 TATTGTCCTCAAGATGCTGCTGG - Intronic
1059370577 9:113829219-113829241 TATTGTCCTTTTGATGTTGCAGG - Intergenic
1060226557 9:121794936-121794958 GCCTGTCCTCGAGATGCTGCAGG + Intergenic
1185653710 X:1667665-1667687 TATTGTCCACAAGCTGCAGTGGG - Intergenic
1186978352 X:14932640-14932662 TAATGTCTTCAAGATGATGCAGG - Intergenic
1188232580 X:27683619-27683641 TTTAGTCCTCAAGCTGCTGAAGG + Intronic
1188912111 X:35862358-35862380 TAGTGTTCTCAATATGATGCAGG + Intergenic
1189020163 X:37327779-37327801 TATTGTTGTAAAGTTGCTGCTGG + Intergenic
1189223663 X:39394883-39394905 TATTGTCATCCAGCTGGTGCTGG + Intergenic
1191115060 X:56843774-56843796 TATAATCCTGAAGGTGCTGCAGG - Intergenic
1192928277 X:75778942-75778964 TATTTTCCTGTAGAGGCTGCAGG - Intergenic
1193067530 X:77275495-77275517 TATTGTCCTCAAGCTGGTGGAGG + Intergenic
1194237701 X:91405013-91405035 TATTGGCATCAGGATGATGCTGG - Intergenic
1195586479 X:106570701-106570723 TTTTGTCATCAGGATGATGCTGG - Intergenic
1197259074 X:124297287-124297309 TTTTGGCATCAGGATGCTGCTGG - Intronic
1200496911 Y:3897474-3897496 TATTTTCCTCCAGATTCTCCGGG - Intergenic