ID: 1059021052

View in Genome Browser
Species Human (GRCh38)
Location 9:110577489-110577511
Sequence ATGTAGCAGCTTAATCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059021052_1059021055 1 Left 1059021052 9:110577489-110577511 CCAGATGGATTAAGCTGCTACAT 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1059021055 9:110577513-110577535 GAAAACTATTTCTCTGATTTGGG No data
1059021052_1059021054 0 Left 1059021052 9:110577489-110577511 CCAGATGGATTAAGCTGCTACAT 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1059021054 9:110577512-110577534 GGAAAACTATTTCTCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059021052 Original CRISPR ATGTAGCAGCTTAATCCATC TGG (reversed) Intronic
911011935 1:93289468-93289490 ATGAAGCAGCATCATTCATCTGG + Intergenic
912977403 1:114342987-114343009 ATGTAGTAGCTAAATCTATGAGG + Intergenic
913037242 1:114982036-114982058 ATATAGCCACTTAATCCATGGGG + Intronic
914784545 1:150816731-150816753 ATTCAGCAGCTGAATCCCTCAGG + Intronic
920989306 1:210921590-210921612 ATTTTGCAGCTTCTTCCATCTGG + Intronic
922043885 1:221924603-221924625 AAGTAGCAGCTTCTTCCTTCAGG - Intergenic
923696953 1:236262704-236262726 ATTTAGCAGCTTAAAACAGCAGG - Intronic
1067421202 10:46150573-46150595 ATTTAACAGTTTAATCCAACAGG + Intergenic
1067491052 10:46703232-46703254 ATTTAACAGTTTAATCCAACAGG + Intergenic
1067506539 10:46857032-46857054 ATTTAACAGTTTAATCCAACAGG + Intergenic
1067603613 10:47637134-47637156 ATTTAACAGTTTAATCCAACAGG - Intergenic
1067942017 10:50665022-50665044 ATGAGGCCGCTTCATCCATCTGG + Intergenic
1069236797 10:66085999-66086021 TTGTACAAGCTAAATCCATCTGG + Intronic
1069611611 10:69776369-69776391 AAGTAGGTGCTTAATCCATTTGG + Intergenic
1078092061 11:8269929-8269951 ATGAATGAGCTTAATCCATTTGG + Intergenic
1079962664 11:26943333-26943355 ATGAAGCATCTGAATTCATCTGG - Intergenic
1088100372 11:106147796-106147818 ATGTTTCAGCTTAAGCAATCAGG - Intergenic
1089225264 11:116914580-116914602 ATGTAGCAGATTAGTCCAGTGGG + Intronic
1091625612 12:2118763-2118785 ATGTAAAAGCTTAGTCCGTCTGG + Intronic
1106935778 13:34717649-34717671 ATGTACACGCTTAATCCATTTGG - Intergenic
1108320619 13:49286219-49286241 CAGTGGCAGCTGAATCCATCAGG + Exonic
1109656610 13:65399679-65399701 ATGTAACAGCTTATTAAATCTGG + Intergenic
1112062293 13:95753116-95753138 AAGAAGCAGCTAAATCCATTAGG - Intronic
1116812639 14:49554342-49554364 GTGAAGCAGCATCATCCATCTGG - Intergenic
1118376027 14:65177916-65177938 ATAAAGAAGCTTTATCCATCTGG - Intergenic
1123220084 14:106847222-106847244 AGATAGAAGCTTAATCCATCTGG + Intergenic
1131147688 15:90024747-90024769 ATGTAGCAGCCTGATCTAGCAGG - Intronic
1131907624 15:97161033-97161055 ATTTAGATGTTTAATCCATCTGG + Intergenic
1133198461 16:4187453-4187475 ATGTATCATCTGAATCCATGGGG - Intergenic
1137437425 16:48467652-48467674 ATGCAAAAGTTTAATCCATCGGG - Intergenic
1139031912 16:62894097-62894119 CTGTAGCAGCTTAGTTCATAGGG + Intergenic
1139492642 16:67294643-67294665 ATGAAGAAGCTTTTTCCATCAGG - Exonic
1149312783 17:55411567-55411589 GTGTAGCAGCTAACTTCATCTGG - Intronic
1157134213 18:45038211-45038233 ATGAAGCAGAATAATCCATCAGG - Intronic
1158719807 18:59914812-59914834 ATGCAGCAGAGAAATCCATCAGG + Intergenic
1158830243 18:61269339-61269361 ATTTAGGTCCTTAATCCATCTGG - Intergenic
1162888689 19:13716161-13716183 AGTTAGCATCTTAATCCATTTGG + Intergenic
1164928881 19:32156716-32156738 ATTTAGCTCTTTAATCCATCTGG + Intergenic
1167033208 19:46977333-46977355 ATGTAGAACCTCAATACATCTGG + Intronic
928426032 2:31178566-31178588 ATTAATCAGCTTAATGCATCAGG - Exonic
929433865 2:41911979-41912001 ATTTAGCACTTTATTCCATCTGG + Intergenic
933493201 2:83015112-83015134 ATGTAGCAGCAAAAACCATATGG - Intergenic
937947824 2:127356729-127356751 ATTTAGGTCCTTAATCCATCTGG - Intronic
938600371 2:132831841-132831863 ATGTAATATATTAATCCATCAGG + Intronic
941106593 2:161361150-161361172 ATGTAACTCTTTAATCCATCTGG + Intronic
942650272 2:178159216-178159238 ATGTTACAGCTTAATGCTTCAGG + Intergenic
947092764 2:226531387-226531409 ATGGAGCAGCTTCATCCATAGGG - Intergenic
948498846 2:238375848-238375870 ATGTACATGCTTAATCCACCTGG + Intronic
1170291240 20:14771145-14771167 ATGTTCCAGCTCAAGCCATCAGG - Intronic
1170413414 20:16114891-16114913 ATATGGCAGCTTTATCCATGTGG + Intergenic
1173319675 20:41976095-41976117 GTGTAGCAGCTCCATCCCTCAGG - Intergenic
1175273845 20:57754055-57754077 ATGCGGCAGCTCAAGCCATCTGG - Intergenic
1175284191 20:57826867-57826889 ATTTAGCAGCTCCAGCCATCTGG + Intergenic
1175655691 20:60768302-60768324 CTGTAGGACTTTAATCCATCTGG + Intergenic
1177888466 21:26775806-26775828 ATGAAGGAGCTGAAGCCATCTGG - Intergenic
1178901039 21:36598861-36598883 ATGTAGCCGATCAATCCAGCAGG + Intergenic
1183175632 22:36222949-36222971 ATGGAGCAGCTTCCTCCATCAGG - Intergenic
1184311404 22:43646656-43646678 ATGTAGATGCTTAATCCATGTGG - Intronic
1184589291 22:45470862-45470884 ATGAAGAAGCTTATTCCAGCGGG - Intergenic
951364316 3:21762230-21762252 ACGGAGCAGCTGAATCCAACAGG - Intronic
952832304 3:37575306-37575328 ATTTAACAGCATATTCCATCAGG + Intronic
955819989 3:62886652-62886674 ATGTCTCAGCTTAAGCCGTCAGG - Intergenic
956097836 3:65736240-65736262 AAGTAGCAGCTTCATCTATGTGG + Intronic
958268671 3:91470936-91470958 ATATATCAGCATAATCCATAAGG + Intergenic
959027451 3:101256868-101256890 ATGCAGCATCTTAACTCATCAGG - Intronic
966020702 3:175205446-175205468 ATTTAGGTACTTAATCCATCTGG - Intronic
967566866 3:190983309-190983331 ATGTGGCTGCTTAATCCGTCTGG - Intergenic
971224883 4:24742705-24742727 ATGTAGCAGCTGCAACCATAAGG + Intergenic
972775454 4:42235739-42235761 CTGGAGAAGCTGAATCCATCTGG - Intergenic
974115819 4:57578173-57578195 ATGTAGCAGAATCATCCATGAGG - Intergenic
975816237 4:78219570-78219592 ATTTAGATGCTTAATCAATCTGG - Intronic
984959615 4:185083003-185083025 TTTTAGAATCTTAATCCATCTGG - Intergenic
985988729 5:3538306-3538328 ATGCAGCAGCTTCAGCCAACAGG + Intergenic
988983206 5:36592362-36592384 ATGTAGCACTTTAATCCAATTGG - Intergenic
993700274 5:91111063-91111085 ATTTAGCAGCTTAAGACATGGGG - Intronic
1000284062 5:159811394-159811416 ATGTTGAAGCTTAATCCCTAAGG + Intergenic
1002294011 5:178219055-178219077 ATATAGGTCCTTAATCCATCTGG - Intronic
1003225847 6:4204767-4204789 ATCTAGCTCTTTAATCCATCTGG + Intergenic
1004034384 6:11908770-11908792 TTGTAGCTGCTTTAACCATCTGG + Intergenic
1007042777 6:38739852-38739874 ATTTAGGTGTTTAATCCATCTGG + Intronic
1008638576 6:53437284-53437306 GTGTAGGAGCTAAATACATCTGG - Intergenic
1008986537 6:57550651-57550673 ATATATCAGCATAATCCATAAGG - Intronic
1009174502 6:60443220-60443242 ATATATCAGCATAATCCATAAGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1016055677 6:139575424-139575446 AGGTGGCATCTTAGTCCATCCGG - Intergenic
1016619267 6:146089152-146089174 ATGTGGCCACTTATTCCATCAGG - Intronic
1017295765 6:152791763-152791785 ATGAAGCAAATTAATCCATGAGG + Intergenic
1019837319 7:3401091-3401113 ATGTATCTTCTAAATCCATCAGG - Intronic
1026524672 7:71143699-71143721 ATGTTGCGGCTTATTGCATCTGG + Intronic
1029331747 7:99862394-99862416 ATGAAGTGGCTTAAACCATCAGG - Intronic
1030026208 7:105327123-105327145 ATTTAGCAGCATATTCCATGAGG + Intronic
1031281324 7:119804423-119804445 ATTTAGAGGCTTAATCCATCTGG + Intergenic
1032929520 7:136650293-136650315 ATGTAGTAGGCTAAACCATCTGG - Intergenic
1033583801 7:142759712-142759734 AGGTAGGAGCTTAGTGCATCTGG - Intronic
1043698062 8:83246169-83246191 ATGTAGAAAATTAAGCCATCTGG + Intergenic
1045048900 8:98305104-98305126 ATGTTCCAGCTCAAGCCATCAGG + Intergenic
1052370534 9:27659666-27659688 ATGTGGCAGCTAAAACCACCAGG - Intergenic
1055203197 9:73693532-73693554 ATGTGCCAGCTTAAGCCTTCAGG + Intergenic
1059021022 9:110576938-110576960 ATTTAGCAGTTTAATCCATCTGG - Intronic
1059021052 9:110577489-110577511 ATGTAGCAGCTTAATCCATCTGG - Intronic
1186093641 X:6076712-6076734 ATGTATCAGATGAATACATCTGG + Intronic
1188124165 X:26347447-26347469 AAGAAGCAGCTGAATTCATCTGG - Intergenic
1189434126 X:40976033-40976055 AGGAAGAGGCTTAATCCATCAGG + Intergenic
1199132861 X:144213911-144213933 ATGTTTCAGCTTAATCAATCTGG - Intergenic
1199569813 X:149256078-149256100 GTGTTGCAGGTTATTCCATCAGG + Intergenic
1199753042 X:150839367-150839389 TTGTAACAGCTAAATCCAACAGG + Intronic
1201504558 Y:14683509-14683531 ATGTATCAGATGAATACATCTGG - Intronic