ID: 1059021566

View in Genome Browser
Species Human (GRCh38)
Location 9:110581709-110581731
Sequence CCACGGTGCTTTGCACATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059021566_1059021571 23 Left 1059021566 9:110581709-110581731 CCTTTATGTGCAAAGCACCGTGG No data
Right 1059021571 9:110581755-110581777 TGTGTTCCCCACACAAACCAAGG No data
1059021566_1059021572 26 Left 1059021566 9:110581709-110581731 CCTTTATGTGCAAAGCACCGTGG No data
Right 1059021572 9:110581758-110581780 GTTCCCCACACAAACCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059021566 Original CRISPR CCACGGTGCTTTGCACATAA AGG (reversed) Intergenic
No off target data available for this crispr