ID: 1059023271

View in Genome Browser
Species Human (GRCh38)
Location 9:110598835-110598857
Sequence GAGTGCCTGGGGGGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059023271_1059023286 26 Left 1059023271 9:110598835-110598857 CCTGCCCTGCCCCCCAGGCACTC No data
Right 1059023286 9:110598884-110598906 TTAGCCTTAGAACATGAGCGGGG No data
1059023271_1059023285 25 Left 1059023271 9:110598835-110598857 CCTGCCCTGCCCCCCAGGCACTC No data
Right 1059023285 9:110598883-110598905 GTTAGCCTTAGAACATGAGCGGG No data
1059023271_1059023284 24 Left 1059023271 9:110598835-110598857 CCTGCCCTGCCCCCCAGGCACTC No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059023271 Original CRISPR GAGTGCCTGGGGGGCAGGGC AGG (reversed) Intergenic
No off target data available for this crispr