ID: 1059023278

View in Genome Browser
Species Human (GRCh38)
Location 9:110598847-110598869
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059023278_1059023285 13 Left 1059023278 9:110598847-110598869 CCCAGGCACTCCATCCCAGGAGG No data
Right 1059023285 9:110598883-110598905 GTTAGCCTTAGAACATGAGCGGG No data
1059023278_1059023284 12 Left 1059023278 9:110598847-110598869 CCCAGGCACTCCATCCCAGGAGG No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023278_1059023289 20 Left 1059023278 9:110598847-110598869 CCCAGGCACTCCATCCCAGGAGG No data
Right 1059023289 9:110598890-110598912 TTAGAACATGAGCGGGGAGTGGG No data
1059023278_1059023286 14 Left 1059023278 9:110598847-110598869 CCCAGGCACTCCATCCCAGGAGG No data
Right 1059023286 9:110598884-110598906 TTAGCCTTAGAACATGAGCGGGG No data
1059023278_1059023288 19 Left 1059023278 9:110598847-110598869 CCCAGGCACTCCATCCCAGGAGG No data
Right 1059023288 9:110598889-110598911 CTTAGAACATGAGCGGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059023278 Original CRISPR CCTCCTGGGATGGAGTGCCT GGG (reversed) Intergenic
No off target data available for this crispr