ID: 1059023281

View in Genome Browser
Species Human (GRCh38)
Location 9:110598857-110598879
Sequence GCTCTAACTTCCTCCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059023281_1059023292 30 Left 1059023281 9:110598857-110598879 CCATCCCAGGAGGAAGTTAGAGC No data
Right 1059023292 9:110598910-110598932 GGGTTGATGTCCCAGCTGGGAGG No data
1059023281_1059023289 10 Left 1059023281 9:110598857-110598879 CCATCCCAGGAGGAAGTTAGAGC No data
Right 1059023289 9:110598890-110598912 TTAGAACATGAGCGGGGAGTGGG No data
1059023281_1059023288 9 Left 1059023281 9:110598857-110598879 CCATCCCAGGAGGAAGTTAGAGC No data
Right 1059023288 9:110598889-110598911 CTTAGAACATGAGCGGGGAGTGG No data
1059023281_1059023286 4 Left 1059023281 9:110598857-110598879 CCATCCCAGGAGGAAGTTAGAGC No data
Right 1059023286 9:110598884-110598906 TTAGCCTTAGAACATGAGCGGGG No data
1059023281_1059023291 27 Left 1059023281 9:110598857-110598879 CCATCCCAGGAGGAAGTTAGAGC No data
Right 1059023291 9:110598907-110598929 AGTGGGTTGATGTCCCAGCTGGG No data
1059023281_1059023284 2 Left 1059023281 9:110598857-110598879 CCATCCCAGGAGGAAGTTAGAGC No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023281_1059023290 26 Left 1059023281 9:110598857-110598879 CCATCCCAGGAGGAAGTTAGAGC No data
Right 1059023290 9:110598906-110598928 GAGTGGGTTGATGTCCCAGCTGG No data
1059023281_1059023285 3 Left 1059023281 9:110598857-110598879 CCATCCCAGGAGGAAGTTAGAGC No data
Right 1059023285 9:110598883-110598905 GTTAGCCTTAGAACATGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059023281 Original CRISPR GCTCTAACTTCCTCCTGGGA TGG (reversed) Intergenic
No off target data available for this crispr