ID: 1059023284

View in Genome Browser
Species Human (GRCh38)
Location 9:110598882-110598904
Sequence TGTTAGCCTTAGAACATGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059023282_1059023284 -2 Left 1059023282 9:110598861-110598883 CCCAGGAGGAAGTTAGAGCTTTG No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023280_1059023284 11 Left 1059023280 9:110598848-110598870 CCAGGCACTCCATCCCAGGAGGA No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023277_1059023284 13 Left 1059023277 9:110598846-110598868 CCCCAGGCACTCCATCCCAGGAG No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023276_1059023284 14 Left 1059023276 9:110598845-110598867 CCCCCAGGCACTCCATCCCAGGA No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023278_1059023284 12 Left 1059023278 9:110598847-110598869 CCCAGGCACTCCATCCCAGGAGG No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023283_1059023284 -3 Left 1059023283 9:110598862-110598884 CCAGGAGGAAGTTAGAGCTTTGT No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023274_1059023284 15 Left 1059023274 9:110598844-110598866 CCCCCCAGGCACTCCATCCCAGG No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023281_1059023284 2 Left 1059023281 9:110598857-110598879 CCATCCCAGGAGGAAGTTAGAGC No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023272_1059023284 20 Left 1059023272 9:110598839-110598861 CCCTGCCCCCCAGGCACTCCATC No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023273_1059023284 19 Left 1059023273 9:110598840-110598862 CCTGCCCCCCAGGCACTCCATCC No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data
1059023271_1059023284 24 Left 1059023271 9:110598835-110598857 CCTGCCCTGCCCCCCAGGCACTC No data
Right 1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059023284 Original CRISPR TGTTAGCCTTAGAACATGAG CGG Intergenic
No off target data available for this crispr