ID: 1059025681

View in Genome Browser
Species Human (GRCh38)
Location 9:110626476-110626498
Sequence AACTTCCGCAGGAAAAACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059025677_1059025681 16 Left 1059025677 9:110626437-110626459 CCTCATTCACACATGTTTTCTTT No data
Right 1059025681 9:110626476-110626498 AACTTCCGCAGGAAAAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059025681 Original CRISPR AACTTCCGCAGGAAAAACTA AGG Intergenic
No off target data available for this crispr