ID: 1059027612

View in Genome Browser
Species Human (GRCh38)
Location 9:110652498-110652520
Sequence TGGTATAATACCTATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059027612_1059027616 4 Left 1059027612 9:110652498-110652520 CCTACCTCATAGGTATTATACCA No data
Right 1059027616 9:110652525-110652547 ATGAGGATTAAATTCCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059027612 Original CRISPR TGGTATAATACCTATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr