ID: 1059029224

View in Genome Browser
Species Human (GRCh38)
Location 9:110672304-110672326
Sequence TGAATAGAGCCACTCCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059029224_1059029232 23 Left 1059029224 9:110672304-110672326 CCTGAAAGGAGTGGCTCTATTCA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1059029232 9:110672350-110672372 CCATGCTGAAGACCCAGCTGGGG No data
1059029224_1059029227 -1 Left 1059029224 9:110672304-110672326 CCTGAAAGGAGTGGCTCTATTCA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1059029227 9:110672326-110672348 AGGAAGATGAGAGGATCACATGG No data
1059029224_1059029233 28 Left 1059029224 9:110672304-110672326 CCTGAAAGGAGTGGCTCTATTCA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG No data
1059029224_1059029228 0 Left 1059029224 9:110672304-110672326 CCTGAAAGGAGTGGCTCTATTCA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1059029228 9:110672327-110672349 GGAAGATGAGAGGATCACATGGG No data
1059029224_1059029230 22 Left 1059029224 9:110672304-110672326 CCTGAAAGGAGTGGCTCTATTCA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1059029230 9:110672349-110672371 GCCATGCTGAAGACCCAGCTGGG No data
1059029224_1059029226 -10 Left 1059029224 9:110672304-110672326 CCTGAAAGGAGTGGCTCTATTCA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1059029226 9:110672317-110672339 GCTCTATTCAGGAAGATGAGAGG No data
1059029224_1059029229 21 Left 1059029224 9:110672304-110672326 CCTGAAAGGAGTGGCTCTATTCA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1059029229 9:110672348-110672370 GGCCATGCTGAAGACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059029224 Original CRISPR TGAATAGAGCCACTCCTTTC AGG (reversed) Intronic
901198906 1:7455777-7455799 AGAAGAGAGCCACTGATTTCTGG + Intronic
903916968 1:26771771-26771793 TGAGCAGAGCCACTCCCATCAGG - Intronic
907672697 1:56490553-56490575 TGAAAAGAGCCCGGCCTTTCAGG - Intergenic
908008854 1:59755020-59755042 TGAAGAGATCCTCTCCCTTCAGG - Intronic
915603947 1:156939176-156939198 GGAAAAGAGCCACTCTTCTCAGG - Intronic
917500098 1:175578095-175578117 TGAATAGATCCAGACCTCTCGGG + Intronic
917601407 1:176577942-176577964 TGAATAGAGCTTCACCTTCCTGG + Intronic
924336133 1:242988547-242988569 TTAACAGAGCCATTCCTTTCAGG + Intergenic
924708830 1:246518382-246518404 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1063222431 10:3982016-3982038 TGAATAGAGTGACTGGTTTCAGG - Intergenic
1070391160 10:75971736-75971758 TTAATAAAGGCATTCCTTTCTGG + Intronic
1070497014 10:77033910-77033932 TGAATAGAGCCAGTTCTGTGAGG + Intronic
1071355432 10:84789147-84789169 TGAATAAAGCCATTCCTCTCTGG + Intergenic
1072210671 10:93243963-93243985 TGAAGACAGCCACTGCTTGCTGG + Intergenic
1072393241 10:95011010-95011032 TGAAGACAGCCACTATTTTCTGG + Intergenic
1074764299 10:116689279-116689301 AAAATGGAGCCCCTCCTTTCAGG - Intronic
1079384310 11:19965279-19965301 TGAATTCAACCACTCATTTCAGG + Intronic
1087590215 11:100177619-100177641 TAAACAGAGACACACCTTTCAGG - Intronic
1089557817 11:119324548-119324570 TGAAAACAGCCAATCCCTTCTGG + Intergenic
1093748248 12:22767943-22767965 TGGCTAGGGCCACTCTTTTCTGG + Intergenic
1097503007 12:60429980-60430002 TGTATTGAGCCTTTCCTTTCTGG - Intergenic
1102250252 12:111381791-111381813 TGAATATGGCCACTGCTTTTAGG + Intergenic
1107123241 13:36818387-36818409 TGAATAAAGTCATTGCTTTCCGG + Intergenic
1109061618 13:57629283-57629305 GAAATAGAGCCTCTCCTTTAAGG - Intergenic
1112101031 13:96189750-96189772 TGAAAGGAGCCACTCCTGTCTGG + Intronic
1113593251 13:111515080-111515102 GAAATACAGCCACTCCTCTCTGG + Intergenic
1114675906 14:24440301-24440323 AGGATGGAGCCACTCCATTCAGG + Exonic
1117233071 14:53742038-53742060 TGAACAGGGATACTCCTTTCAGG + Intergenic
1125603920 15:40929553-40929575 TGAAAAGAGGCGCTCCTCTCGGG - Exonic
1128233279 15:66050220-66050242 TGACTAGAGCCCCTACATTCTGG + Intronic
1128976265 15:72155999-72156021 CGGATAGAGCCATTCTTTTCGGG + Intergenic
1130630772 15:85566926-85566948 TGAATAAAGTCAGTCATTTCCGG - Intronic
1136495449 16:30640575-30640597 TGAGGAGAGCCACTGCTTTCAGG + Intergenic
1139461430 16:67125719-67125741 TGAAAAGAGCCTCTCCCTTCTGG - Intronic
1140231237 16:73118990-73119012 TGATTACAGTCACTCCTTTCAGG + Intergenic
1143204419 17:5132302-5132324 GGGACAGAGCCAGTCCTTTCTGG + Intronic
1145760143 17:27421010-27421032 GGGACAGAGCCAGTCCTTTCTGG + Intergenic
1145798910 17:27671316-27671338 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1146160163 17:30555297-30555319 GGGACAGAGCCAGTCCTTTCTGG + Intergenic
1146844244 17:36173519-36173541 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1146856549 17:36261454-36261476 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1146864068 17:36326921-36326943 GGGACAGAGCCAGTCCTTTCTGG + Intronic
1146872459 17:36385365-36385387 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1146879817 17:36436450-36436472 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1146883740 17:36457601-36457623 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1147066928 17:37927509-37927531 GGGACAGAGCCAGTCCTTTCTGG + Intronic
1147075343 17:37985989-37986011 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1147078460 17:38007070-38007092 GGGACAGAGCCAGTCCTTTCTGG + Intronic
1147086868 17:38065535-38065557 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1147094398 17:38131005-38131027 GGGACAGAGCCAGTCCTTTCTGG + Intergenic
1147102813 17:38189498-38189520 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1148172721 17:45536611-45536633 TGAATAGAGCCTAACCTTCCAGG - Intergenic
1148276550 17:46308838-46308860 TGAATAGAGCCTAACCTTCCAGG + Intronic
1148298667 17:46526426-46526448 TGAATAGAGCCTAACCTTCCAGG + Intronic
1148363200 17:47030923-47030945 TGAATAGAGCCTAACCTTCCAGG + Intronic
1149847387 17:60015965-60015987 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1150085745 17:62272582-62272604 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1150403926 17:64883531-64883553 TGAATAGAGCCTAACCTTCCAGG - Intronic
1153740712 18:8124476-8124498 TGAATCGACCAACTCTTTTCAGG + Intronic
1155256762 18:24004825-24004847 TGAATAGCCACACTGCTTTCTGG + Intronic
1165336410 19:35173147-35173169 TAAATAGAGACACTCTTATCAGG + Intergenic
927394425 2:22632880-22632902 TGAACTAAGCTACTCCTTTCAGG + Intergenic
929549231 2:42878988-42879010 AGAATAGAGAGACTCGTTTCTGG + Intergenic
929864800 2:45708920-45708942 GGAAGAGAGCCACTCCTGTGTGG + Intronic
935649317 2:105368721-105368743 TAAATAGATACACTTCTTTCTGG - Intronic
936620602 2:114093246-114093268 TGAATAAAGCAACTCTGTTCAGG + Intergenic
938743450 2:134254394-134254416 TGAAGAGAGCCATTGCTCTCTGG - Exonic
939278565 2:140033257-140033279 TCAATAGAGTAACTCCTTTTCGG - Intergenic
939862511 2:147436703-147436725 TGAAGAGATACACTCTTTTCCGG + Intergenic
942476278 2:176325968-176325990 TCAATAGATTCACTCCTCTCTGG - Intronic
945270347 2:207932101-207932123 TAATAAGAGCAACTCCTTTCTGG - Intronic
945924703 2:215791411-215791433 TGCATAGGTCCACTTCTTTCTGG - Intergenic
1168924040 20:1565320-1565342 TGAATAGAGACACTGCTTTGGGG + Exonic
1181303851 22:21902901-21902923 GAAATAAAGCCACACCTTTCTGG - Intergenic
1184611159 22:45604432-45604454 TGAATAAAGACTATCCTTTCGGG - Intergenic
950910497 3:16584613-16584635 TGGATAGAGACACACCATTCTGG - Intergenic
952179424 3:30902388-30902410 CCAATAGAGCCAGTACTTTCTGG + Intergenic
957679848 3:83419672-83419694 TTAGTAGAGCCAATCTTTTCTGG - Intergenic
962781823 3:138726334-138726356 TGAATAAAGCCGCAGCTTTCTGG - Intronic
970009498 4:11443725-11443747 TGAATAGTAGCACTGCTTTCAGG - Intergenic
971998091 4:33993383-33993405 TGAATAGACCCTGTCCTCTCAGG - Intergenic
972648219 4:40990425-40990447 TGAATCTCACCACTCCTTTCTGG - Intronic
975818143 4:78241110-78241132 TGAATAAAGGCCATCCTTTCAGG + Intronic
976857230 4:89619075-89619097 TGAATTGAAGCAATCCTTTCAGG + Intergenic
979240993 4:118446745-118446767 TTAACAGAGCCATTCCTTTCAGG - Intergenic
981687875 4:147475307-147475329 TGAACAGAACCAGTCCTTGCTGG - Intergenic
984607212 4:181799181-181799203 GGATTACAGCCACTCGTTTCAGG - Intergenic
988314746 5:29610334-29610356 TGAAAAGAGACAATACTTTCAGG - Intergenic
993325308 5:86526999-86527021 TGTCTAGAGCCACTGCTGTCGGG - Intergenic
995978069 5:118066257-118066279 TGAAAAAAGCCAGTCTTTTCTGG + Intergenic
997263278 5:132479862-132479884 GGGATAGAGCCAGACCTTTCAGG - Intergenic
1002718274 5:181242499-181242521 GGAATAGAGCCACTCAGTCCTGG - Intronic
1006308461 6:33239837-33239859 TGAATTCAGCCACGCCTTTTGGG - Intergenic
1006583760 6:35092084-35092106 TCATTAGCCCCACTCCTTTCCGG + Intergenic
1007632080 6:43278088-43278110 TGCATGGAGCCACTCCTGCCTGG - Intronic
1007871529 6:45044817-45044839 AGAATAAAGCCACTTCTCTCTGG + Intronic
1011403285 6:86988239-86988261 TGCATAGAACCACTAGTTTCAGG - Intronic
1016104501 6:140145685-140145707 AGAAGAGAGCAACTCCTTTTGGG + Intergenic
1016288202 6:142497682-142497704 TTAAAAGTGCCACTCATTTCTGG - Intergenic
1018448564 6:163882582-163882604 TGAATAGGGAAACGCCTTTCTGG + Intergenic
1019019336 6:168904387-168904409 TAAATGGAGCCATTCCTCTCGGG + Intergenic
1021627081 7:22603889-22603911 TGAATAAGGACACTTCTTTCAGG + Intronic
1023939626 7:44761318-44761340 TGAAGGGAGCCCCTCCTGTCAGG - Intronic
1028045247 7:86109536-86109558 TGAATAGATTCACTCTGTTCTGG + Intergenic
1031113446 7:117639973-117639995 TGAATAGAACATTTCCTTTCAGG - Intronic
1031996298 7:128233711-128233733 TGAAAAGAGTCTGTCCTTTCTGG + Intergenic
1033609596 7:142953155-142953177 GGAAGAAAGCCACTGCTTTCAGG + Intronic
1033851792 7:145505158-145505180 TGAATAAAGCCATAGCTTTCTGG + Intergenic
1034793890 7:153994600-153994622 TGAAATGAGCAACTTCTTTCTGG - Intronic
1043104883 8:76095548-76095570 TGAATACATCAACTCCCTTCTGG + Intergenic
1046196098 8:110864526-110864548 TCAATAGAGACACATCTTTCAGG + Intergenic
1059029224 9:110672304-110672326 TGAATAGAGCCACTCCTTTCAGG - Intronic
1060162713 9:121380661-121380683 TCACTACAGCCTCTCCTTTCCGG - Intergenic
1060938831 9:127531710-127531732 TGAAGAGAGCCACGCCATACTGG + Exonic
1060961126 9:127681552-127681574 TGAAAGGAGCAAGTCCTTTCTGG - Intronic
1061878860 9:133558400-133558422 TGAAAATAGCCTTTCCTTTCTGG - Intronic
1189579756 X:42393803-42393825 TGAATGGAGCTACTCCATTTTGG + Intergenic
1190324120 X:49196171-49196193 TGCTTAGAGCCAGTCCTTTGGGG - Intronic
1193568645 X:83113144-83113166 TGAAAAGAGCCATTACTTTTTGG + Intergenic
1202388712 Y:24348560-24348582 TTAACAGAGCCATTCCTTTCAGG - Intergenic
1202482075 Y:25321569-25321591 TTAACAGAGCCATTCCTTTCAGG + Intergenic