ID: 1059029233

View in Genome Browser
Species Human (GRCh38)
Location 9:110672355-110672377
Sequence CTGAAGACCCAGCTGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059029224_1059029233 28 Left 1059029224 9:110672304-110672326 CCTGAAAGGAGTGGCTCTATTCA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059029233 Original CRISPR CTGAAGACCCAGCTGGGGCT AGG Intronic
No off target data available for this crispr