ID: 1059030061

View in Genome Browser
Species Human (GRCh38)
Location 9:110683116-110683138
Sequence AAGGGTAGTACAGGGATCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059030061 Original CRISPR AAGGGTAGTACAGGGATCGG GGG (reversed) Intronic
900427200 1:2586272-2586294 AGGGGTGGTCCAGGGAGCGGCGG - Intergenic
901535949 1:9883125-9883147 GAGGGTAGGTCAGGGACCGGGGG + Intronic
902838284 1:19060277-19060299 AATGGTGGTCCAGGGATCTGTGG - Intergenic
910030776 1:82719975-82719997 AAGGGTAGTAGGGGGTTGGGAGG - Intergenic
913975857 1:143454490-143454512 AAAGGTAGCACAGGGATTAGGGG + Intergenic
914070252 1:144280109-144280131 AAAGGTAGCACAGGGATTAGGGG + Intergenic
914108903 1:144686245-144686267 AAAGGTAGCACAGGGATTAGGGG - Intergenic
914442724 1:147721348-147721370 AAGGGAAGTACAGTGTTCAGAGG + Intergenic
916401764 1:164457146-164457168 AAGGGTAGTAGGAGGATGGGAGG + Intergenic
917300045 1:173563840-173563862 AAGGGTAGTAGGGGGATAAGGGG - Intronic
917558950 1:176124410-176124432 AGGGGTAGTACGGGGCTGGGGGG - Intronic
920497817 1:206468001-206468023 AAGGGTAGTGCAAGGACCAGAGG - Intergenic
923258407 1:232242696-232242718 AAGGGTAGTGGAGGGCTTGGGGG + Intergenic
1070229642 10:74551183-74551205 AAGGATAGTATTGGGATCAGTGG + Intronic
1072718651 10:97767543-97767565 AAGGGTAGTAGAGGGAGCAGGGG + Exonic
1073743912 10:106443861-106443883 AAGGGTAGTAGAGTGATGGAGGG + Intergenic
1075560432 10:123464327-123464349 AAGGGTAGGAGAGGGAGGGGAGG - Intergenic
1077730230 11:4722641-4722663 CAGGGTAGCACAGGGAACAGGGG - Intronic
1080458972 11:32437455-32437477 AAGGGAGATACAGGGATCTGGGG - Intergenic
1082695886 11:56364056-56364078 AAGGGTAGTAGGGGGATAAGGGG - Intergenic
1084683412 11:70679988-70680010 ACGGGTGGGACAGGGGTCGGTGG + Intronic
1084694860 11:70746995-70747017 GAGGGGAGTACAGGGGTAGGGGG - Intronic
1088597464 11:111450874-111450896 AAGGGTAGGGGAGGGATAGGAGG - Intronic
1088682057 11:112251938-112251960 AAGGGTTTTAAAGGGATTGGGGG - Intronic
1090727022 11:129537484-129537506 AAGAATAGTCCAGGGATCAGGGG + Intergenic
1093089478 12:14905158-14905180 AGGTGTAGTACAGAGATCTGGGG + Intronic
1093130414 12:15385261-15385283 AAGGGAAGTCCAGGGAGCAGAGG + Intronic
1093151354 12:15625554-15625576 AAGTGTAGTAGAGAGATGGGGGG - Intronic
1098918152 12:76278334-76278356 AAGAGGGGTACAGGGATGGGAGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102205891 12:111090563-111090585 TAGTGTAGTAAAGGGATCGCAGG - Intronic
1104005235 12:124887179-124887201 AAGAGGAGTACAGGTGTCGGGGG - Intergenic
1105223379 13:18355244-18355266 AAAGGTAGCACAGGGATTAGGGG - Intergenic
1106172290 13:27298312-27298334 AAGGGTAGAACCAGGATGGGTGG + Intergenic
1110678297 13:78277131-78277153 CATGGTACTACAGGGATGGGAGG - Intergenic
1111449442 13:88394455-88394477 AAGGGTAGTATGGGGAGAGGGGG + Intergenic
1112569896 13:100584479-100584501 AAGGGTAGTAGGGGGGTTGGGGG + Intronic
1114953028 14:27781058-27781080 AAGGGAAGTTCAAGGATCAGAGG + Intergenic
1120688563 14:87566652-87566674 AAGGGGAGTACTGGGATATGTGG - Intergenic
1120922311 14:89766127-89766149 AAGGGAAGAACAGGCATTGGGGG + Intergenic
1127383286 15:58447775-58447797 AAGTGTAGTTCAGGGACCAGTGG - Intronic
1128761191 15:70217075-70217097 AAGGGAAGCACAGGGAGTGGAGG - Intergenic
1138856093 16:60694664-60694686 AAGGGTAGTGCAGGGGTGAGAGG + Intergenic
1140550888 16:75864321-75864343 AAGGGTAGTGGGGGGATAGGGGG - Intergenic
1141882702 16:86870328-86870350 GAGGGTAGGACAGGGGTCCGGGG - Intergenic
1144289886 17:13816164-13816186 AAGGGAAGTACAGGGATAAGTGG + Intergenic
1147346610 17:39801172-39801194 AAGTGTTTTACAAGGATCGGGGG + Intronic
1153883844 18:9445658-9445680 ATGGGTAGCAGTGGGATCGGTGG + Intergenic
1155442038 18:25872235-25872257 AGGGGAAGTACAGGGATCTGGGG - Intergenic
1155699652 18:28727767-28727789 AAGGGTAGTTCAGGTATTGGTGG + Intergenic
1158510444 18:58085515-58085537 AAGGGAAGTAAAAGGATTGGAGG + Intronic
1159887145 18:73919680-73919702 AATGGTGGAACAGGGATTGGTGG + Intergenic
1161380108 19:3960239-3960261 AAGGGTACTGCAGGGAGCGTGGG + Intronic
1162403129 19:10457965-10457987 AAGTGTGGTACAGGGGGCGGGGG - Exonic
1162698298 19:12494621-12494643 AAGGGTAGTGCGGGGGTTGGGGG + Intronic
1166372541 19:42310195-42310217 AAGGGGAGTACAGGGGCAGGAGG - Intronic
926139769 2:10361223-10361245 AATGGTTGTAGAGGGATGGGAGG + Intronic
928785877 2:34885495-34885517 AAGGGTAGTAGAGGGAATGGAGG - Intergenic
930739400 2:54814512-54814534 AAGGGTGGCACAGGAAACGGAGG - Intronic
933275318 2:80277838-80277860 AAGGGCAGAACAGGGCTCTGAGG - Intronic
934180555 2:89615468-89615490 AAAGGTAGCACAGGGATTAGGGG + Intergenic
934290855 2:91689730-91689752 AAAGGTAGCACAGGGATTAGGGG + Intergenic
934899655 2:98148738-98148760 AAGGGTAGCACAGAGGTCAGTGG - Intronic
935743959 2:106174856-106174878 AAGGGTGGCCCAGGGATGGGTGG - Intronic
937293544 2:120796446-120796468 AAGGGAAGTGCAGGCATCAGAGG - Intronic
940699808 2:157026669-157026691 AAGGGTAGTAGGGGGGTGGGTGG + Intergenic
942524139 2:176835189-176835211 AAGGGTAGTAGGGGGATGGGAGG + Intergenic
947708296 2:232293954-232293976 AAGGGCAGTAGAGGGCCCGGAGG + Intronic
1173303349 20:41824588-41824610 AAGGGTAGTAGAGGGTTAGAGGG - Intergenic
1176731928 21:10507679-10507701 AAAGGTAGCACAGGGATTAGGGG - Intergenic
1177105703 21:16952897-16952919 AAGGGTAGTTGAAGGATAGGGGG + Intergenic
1181848339 22:25731307-25731329 AAGGGTAGTATGGGGATGGAGGG - Intergenic
1183512158 22:38242635-38242657 AGGGGAAATACAAGGATCGGGGG + Intronic
1185285740 22:49999374-49999396 GAGGGGAGCACAGGGATGGGTGG - Intronic
951281588 3:20756694-20756716 AAGGGTAGTAGTGGCATGGGAGG + Intergenic
953100536 3:39821317-39821339 CGGGGTGGTACAGGGGTCGGGGG - Intronic
954299564 3:49692613-49692635 AAGGGTAGTATAGGGCTTGTGGG - Intronic
954893487 3:53954722-53954744 CAGGGCAGTAGAGGGATGGGGGG + Intergenic
955249382 3:57263395-57263417 AAGGGTAGTGTGGGGATGGGGGG - Intronic
955554885 3:60126265-60126287 AAGGTTAGTACAGGAACCTGGGG - Intronic
955838259 3:63082404-63082426 GAGGGTAGTAGGGGGATGGGAGG - Intergenic
956893608 3:73637679-73637701 AAGGGTCATGCAGGGATGGGGGG - Intergenic
960184740 3:114624696-114624718 AAGGGAAGTTCAGGGAAGGGGGG + Intronic
960975723 3:123172117-123172139 AAGGGAAGAACAGGGTTGGGTGG - Intronic
960977061 3:123185822-123185844 AAGGGTAGTAGAGGGCTGAGGGG - Intronic
963286876 3:143442026-143442048 ATGGGTAGTTAAGGGATGGGTGG - Intronic
967395594 3:189005106-189005128 AAGGGTAGTAATGGGCTGGGAGG + Intronic
967632620 3:191763698-191763720 AAGGGTAGTGGAGGGATATGGGG - Intergenic
968517688 4:1021750-1021772 AAGGGCAGTAGGGGGATGGGGGG - Intronic
970070223 4:12149937-12149959 AAGGGTAGTTGGGGGATAGGGGG - Intergenic
973208305 4:47585631-47585653 AAGGGTAGTGGAGGTATCAGGGG - Intronic
977186045 4:93937717-93937739 AAGGGTAGTAGTGGGGTAGGGGG + Intergenic
980827442 4:138089392-138089414 AATGGCATTACAGGGATCGATGG + Intergenic
984562213 4:181284030-181284052 AAAGGAAGTACAGGTATTGGTGG + Intergenic
991255401 5:64608039-64608061 AAGGTTAGGACAGGGAAAGGAGG + Intronic
994320699 5:98391961-98391983 CAGAGTAGCACAGGGAACGGGGG - Intergenic
996175332 5:120349544-120349566 AAGGGTAGTAGAGGATTGGGGGG - Intergenic
996459971 5:123730959-123730981 AAGGGTAGTGCAGGGCTAGATGG + Intergenic
996816971 5:127584869-127584891 CAGGGTAGTACAGGGTTCTTAGG - Intergenic
1001619707 5:173073283-173073305 AAGGGTTGGACAGGGACTGGGGG + Intronic
1005971328 6:30764136-30764158 AAGGGGAGGACAGGGGCCGGGGG + Intergenic
1008810493 6:55491965-55491987 TAGTGTAGTAGAGGGATCTGAGG - Intronic
1010954193 6:82071498-82071520 CAGGGTAGTAAAGGGATGGGGGG + Intergenic
1013370915 6:109470399-109470421 AAGGGTAGGGGTGGGATCGGTGG - Intronic
1013990691 6:116251619-116251641 AAGGGAAGAAAAGGGATGGGAGG + Exonic
1015293554 6:131564750-131564772 AAGGGTAGTAGGAGGATGGGGGG - Intergenic
1016456869 6:144240068-144240090 AAGGATAGTGAAGGGATGGGGGG - Intergenic
1018218728 6:161557700-161557722 ATGTGAAGTACAGGGATCCGAGG + Intronic
1026073845 7:67147799-67147821 AAGGGGAGAATAGGGATTGGTGG + Intronic
1026703038 7:72664387-72664409 AAGGGGAGAATAGGGATTGGTGG - Intronic
1027320175 7:77005877-77005899 AAGGGGAGGACCGGGGTCGGGGG - Intergenic
1030733919 7:113021473-113021495 AAGGGTAGTAGAGGGTTGGGTGG - Intergenic
1033238996 7:139661513-139661535 AAGGGTAGTAGAAGGATCTGGGG - Intronic
1033819508 7:145117070-145117092 AAGGGTAGTGCGGAGATAGGAGG - Intergenic
1034597661 7:152213778-152213800 AAAGGTAGCACAGGGATTAGGGG + Intronic
1035708253 8:1694217-1694239 AAGAGTGGTACAGGGAGGGGTGG + Intronic
1037894369 8:22641939-22641961 AAGGTTAGGATCGGGATCGGGGG + Intronic
1037922278 8:22815837-22815859 AAGGGGAGTGCAGGAGTCGGGGG + Intronic
1040632737 8:49235027-49235049 AAGGGTAGTAGGGGGTTAGGGGG - Intergenic
1041914398 8:63125501-63125523 AAGAGTAGTAGAGGGAAGGGAGG - Intergenic
1042358489 8:67855354-67855376 AAGGGTAGTGGAGGGTTCAGGGG + Intergenic
1043557606 8:81450599-81450621 AAGGGTAGTGCAGGAATTGTGGG - Intergenic
1044963184 8:97551090-97551112 AAGGGTATTACAGGATTCTGAGG - Intergenic
1046090336 8:109496130-109496152 GAAGGTAGTACAGAGATAGGTGG - Intronic
1046315565 8:112496798-112496820 AAGGGTAGTAGAGGTGTTGGGGG + Intronic
1047242030 8:123099495-123099517 AAGGGTAGTGGAGGGGTAGGAGG - Intronic
1047545181 8:125809683-125809705 AAGTGATGTACAGGAATCGGAGG - Intergenic
1048185679 8:132238410-132238432 AAGGGTACTTCAGGGTTCAGGGG - Intronic
1055388768 9:75795607-75795629 AAGGGTAGTAGGGGGCTGGGGGG - Intergenic
1056826439 9:89879386-89879408 AAGGGCAGGATAGGGACCGGAGG - Intergenic
1059030061 9:110683116-110683138 AAGGGTAGTACAGGGATCGGGGG - Intronic
1059613342 9:115922683-115922705 AAGGGTACTACAGGGAGTGGTGG - Intergenic
1062017919 9:134301036-134301058 AAAGGGAGAACAGGGATGGGAGG + Intergenic
1188162834 X:26823060-26823082 AAGGGTAGTATAGGAATCCTGGG + Intergenic
1188472941 X:30560647-30560669 AAAGGAAGTACAGGGGTGGGGGG + Intronic
1188788275 X:34375851-34375873 AAGGGTAGTGGGGGGATAGGAGG + Intergenic
1189577569 X:42370969-42370991 AAGGGTAGTGGGGGGATTGGTGG - Intergenic
1191189032 X:57646194-57646216 AAGGGTAGTAGAGGGATGAGAGG + Intergenic
1192046248 X:67676975-67676997 AAGGGTAGTACTGGCAGTGGTGG + Intronic
1192062873 X:67847832-67847854 AAGGGTAGTAGGGGGCTGGGAGG + Intergenic
1192154000 X:68729848-68729870 AAGGGTAGTAAGGGGGTGGGTGG + Intergenic
1194017126 X:88636660-88636682 AAGAGTAGTTCAGGGGTTGGGGG + Intergenic
1195852628 X:109299466-109299488 AAAGGTATTATAGGGATCTGAGG - Intergenic
1196509209 X:116486269-116486291 AAAGGTAGTAGAGGAATTGGGGG + Intergenic
1197903916 X:131403110-131403132 AAGAGTGGTACAGGAATGGGTGG + Intergenic
1198073537 X:133172721-133172743 ATGGCTAGAACAGGGATGGGTGG + Intergenic
1198821186 X:140650347-140650369 AAGGGGAGTACAGGCAAAGGAGG - Intergenic
1199156576 X:144555965-144555987 AAGGGTAGTGCAGGGCTGGAAGG + Intergenic
1199194458 X:145010883-145010905 AAGGGTAGTGAGGGGATGGGAGG + Intergenic
1199660256 X:150042360-150042382 AAGGGTAGTAAAAGGGTGGGTGG - Intergenic
1199883430 X:151995209-151995231 AAGGTTAGTACAGGTATCAGAGG - Intergenic