ID: 1059031458

View in Genome Browser
Species Human (GRCh38)
Location 9:110702146-110702168
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059031456_1059031458 12 Left 1059031456 9:110702111-110702133 CCAGCAATATAACAGACAAGATA 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1059031458 9:110702146-110702168 TCCAACTAGCCCGGAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr