ID: 1059032012

View in Genome Browser
Species Human (GRCh38)
Location 9:110708217-110708239
Sequence AATTTGATCTCTAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059032012_1059032014 1 Left 1059032012 9:110708217-110708239 CCTTCTTTCCTAGAGATCAAATT 0: 1
1: 0
2: 1
3: 29
4: 283
Right 1059032014 9:110708241-110708263 ACTTGTTGCATCTACAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059032012 Original CRISPR AATTTGATCTCTAGGAAAGA AGG (reversed) Intronic
901890628 1:12260428-12260450 AAATTGAGCTCTATGAAAGAAGG - Intronic
902688280 1:18093249-18093271 AGATTGAGCTGTAGGAAAGAGGG - Intergenic
903148921 1:21391353-21391375 CATTTGGTCTCTGGGCAAGATGG - Intergenic
904943465 1:34181585-34181607 AATGTGAGCTCTAGGAAGGCAGG - Intronic
905946712 1:41907383-41907405 ACCTTGAACTCTGGGAAAGATGG + Intronic
907288617 1:53398014-53398036 AATTAGATGTATATGAAAGATGG + Intergenic
908738040 1:67296852-67296874 AATTGGATGGCTGGGAAAGATGG - Intergenic
911683278 1:100743877-100743899 ATTTTGATCTAAAGGAAAGGGGG + Intergenic
911736333 1:101340450-101340472 TGTTTGAGCTCAAGGAAAGATGG + Intergenic
911835188 1:102610078-102610100 AATTTGAGCGATTGGAAAGAAGG + Intergenic
911998748 1:104801807-104801829 ATTTTGAACTATAGGTAAGATGG - Intergenic
912166581 1:107048541-107048563 AATTTGAGCTCCAGAAAGGAAGG + Intergenic
912719500 1:112007632-112007654 AATTTGAGCTTTAGTAAGGAAGG - Intergenic
912902329 1:113665271-113665293 AAGTTGATATATAGGAGAGATGG - Intronic
912965066 1:114230059-114230081 AGGTTGCTCTCTAGGAAAGCTGG - Intergenic
913985909 1:143565968-143565990 AATTTCATCTGTAGTAAAGCAGG + Intergenic
914255542 1:145959304-145959326 AAGTTGGTTTCTTGGAAAGAAGG + Intergenic
915713293 1:157921623-157921645 GCTTTGATCTCTAGGAAAACTGG + Intergenic
917156206 1:172001711-172001733 AATTTCATCTCAAGAGAAGATGG - Intronic
917394125 1:174573848-174573870 AATTTAAACTCTATTAAAGAAGG + Intronic
918098290 1:181352173-181352195 GATTTGATCAGCAGGAAAGAGGG + Intergenic
918130575 1:181624247-181624269 AATTGGATCTCTAGGGTTGAAGG - Intronic
918454745 1:184697565-184697587 TATTTGATATATAGCAAAGATGG + Intronic
919253000 1:195083302-195083324 AATTTGATCTCCAGGATTGGAGG - Intergenic
920095333 1:203483064-203483086 AACTAGAGCTCTAGGGAAGATGG - Intronic
920262302 1:204697260-204697282 AATTCCATCTATAGGAACGACGG + Intergenic
922268130 1:224006803-224006825 AAATTAAACTCTAGGAAAAAAGG - Intergenic
922350716 1:224732816-224732838 AAGTTGATCTCTATGGAGGAAGG + Intronic
923125296 1:231029083-231029105 AATATGACCACTAGGAAACAAGG + Intronic
923271181 1:232356512-232356534 AATTTTATCCATAGGAAAAATGG - Intergenic
924077560 1:240356633-240356655 AATCTGATCTTTAGAAGAGATGG - Intronic
924720485 1:246618388-246618410 AATGTTATCTCAAGGTAAGATGG + Intronic
1063325721 10:5099714-5099736 AATTAGAACTCAAGGAAAGGTGG + Intronic
1063620616 10:7644068-7644090 AATTGTATTTCTAGTAAAGACGG - Intronic
1064709900 10:18112287-18112309 AGCTTCATCTCTAGTAAAGAGGG + Intergenic
1064933735 10:20656418-20656440 AATTAGAGTTCTAGGAAAAATGG - Intergenic
1065991279 10:31012782-31012804 AATCTGATCTCCCAGAAAGAGGG + Intronic
1066196070 10:33101466-33101488 AGTTAGATACCTAGGAAAGAGGG - Intergenic
1067991417 10:51217204-51217226 ATTTTTATATCTATGAAAGAAGG - Intronic
1072028794 10:91496296-91496318 ATTTTGATCACTAGGAATGATGG - Exonic
1072177961 10:92947735-92947757 AATTTTATTTTTAGTAAAGAAGG - Intronic
1072224398 10:93355034-93355056 AATTTTAACTATAGGAAAAAAGG - Intronic
1072725110 10:97807784-97807806 AATGTGATCTCTAGAACAGGTGG - Intergenic
1072965848 10:99971992-99972014 ATTTTGGCTTCTAGGAAAGAAGG - Exonic
1073758831 10:106609057-106609079 AATTTCCACTCCAGGAAAGATGG + Intronic
1074686985 10:115970686-115970708 AATTTTATTTTTAGTAAAGATGG + Intergenic
1076135735 10:128044920-128044942 AATTTCTTCTTTAGGAAAGTGGG + Intronic
1076846736 10:133072928-133072950 AATTTGTTGCCTAGGAAAGTCGG - Intronic
1077448328 11:2614741-2614763 AATGTGGTCTCTAGGACACAAGG - Intronic
1077452225 11:2655253-2655275 ATTTTGTTTTCTAGGAAAGTGGG - Intronic
1078381383 11:10844724-10844746 ATTTTGTACTCTAGGAAAAAAGG - Intronic
1078944254 11:16045935-16045957 AATATAAGCTCTAGGAAAGCAGG + Intronic
1079613742 11:22465083-22465105 AAATTGATATCTAAGAAAGTTGG - Intergenic
1079892793 11:26079124-26079146 AATTTAATATATAGGCAAGATGG - Intergenic
1079947659 11:26764319-26764341 CATGTGGTCTCTGGGAAAGATGG - Intergenic
1081110095 11:39124903-39124925 AATTGAAGCTCTAGGAAAGTCGG - Intergenic
1081311978 11:41585463-41585485 AATCTCATGTATAGGAAAGATGG + Intergenic
1083969245 11:66063275-66063297 AATTTGAGCTCTAGGTAGGTAGG + Intronic
1084054044 11:66620027-66620049 AATTAGATCTGTGGGCAAGAAGG + Intronic
1088882739 11:113984305-113984327 AAGTTTATATCTAGGAGAGAAGG - Intronic
1090428742 11:126628733-126628755 AATCTGATGAATAGGAAAGATGG - Intronic
1091419971 12:328427-328449 AATTTGATGAATAGGAAGGATGG - Intronic
1093410550 12:18860204-18860226 AATTTGCACTCTAGAAAGGAAGG + Intergenic
1094594149 12:31848576-31848598 CTTGTGATCTCTGGGAAAGATGG - Intergenic
1094654107 12:32404343-32404365 AATTTCATCTCTGGGGAAGAGGG + Intronic
1094768370 12:33623717-33623739 AATTAGATTTATAGGCAAGAGGG - Intergenic
1095714730 12:45330687-45330709 AATTTGTTTGCTAGGAATGAGGG + Intronic
1097396763 12:59084695-59084717 AAATTGTTCTTCAGGAAAGATGG - Intergenic
1099154049 12:79152273-79152295 AATTTGATCAGGAGGAGAGAGGG + Intronic
1099543256 12:83941800-83941822 AATTTGATCCCTAGGGTTGAAGG - Intergenic
1100778226 12:97995716-97995738 ACTTTGCTCTCTTGGAAAAAGGG + Intergenic
1101171412 12:102099890-102099912 AATTTGAGTTTTTGGAAAGAAGG - Intronic
1101822477 12:108194737-108194759 AATGTGAGCTCTATGAAAGAGGG + Intronic
1102276143 12:111583438-111583460 AATTTAAGCTCTATGAAAGCAGG - Intronic
1102677398 12:114668061-114668083 AAAGTGATATCCAGGAAAGAGGG + Intergenic
1103105902 12:118224721-118224743 AGTTTGATCTTTAGGAAAGAAGG + Intronic
1103814635 12:123644323-123644345 AAGGTGAGCTCGAGGAAAGAAGG + Intronic
1104805917 12:131589129-131589151 AATTTTATCTTTAGTATAGATGG + Intergenic
1105683570 13:22753679-22753701 AATGTGATCCCTAGAAATGAAGG + Intergenic
1107664833 13:42678007-42678029 AATTTTATCTCTAGGAACAATGG + Intergenic
1108909876 13:55534666-55534688 AATGTGAGAACTAGGAAAGAAGG + Intergenic
1109067798 13:57722440-57722462 AATTTTATCTTTCAGAAAGAAGG - Intronic
1109530365 13:63635563-63635585 AATTTTATCTCTTGCAAAAAAGG - Intergenic
1109999208 13:70173022-70173044 AATTGTATCTCTTTGAAAGAGGG + Intergenic
1111158657 13:84363239-84363261 AATTTGTTCTCTAAAAATGATGG + Intergenic
1111473284 13:88714228-88714250 AATTTGATATGTGAGAAAGACGG + Intergenic
1112730558 13:102355994-102356016 AAATTGATGTCTGGGAGAGACGG - Intronic
1112837258 13:103531211-103531233 AGTTTGATATGTAGAAAAGAAGG - Intergenic
1113912392 13:113849152-113849174 AAGTTGTGTTCTAGGAAAGATGG + Intronic
1113984122 13:114300319-114300341 CATTTTATCTGTAGAAAAGAAGG + Intronic
1114728329 14:24963319-24963341 ACTTGGATCTCAAGGAATGAAGG + Intronic
1115109037 14:29798919-29798941 AATTAGAACTCAAGGACAGAGGG - Intronic
1116922109 14:50589648-50589670 AATTTCCACTCTAGGGAAGAAGG - Intronic
1117289398 14:54317911-54317933 AATGTGAACTATAGGAAAGAAGG - Intergenic
1118435970 14:65771182-65771204 AGTTTGACCTTTAGGAAAAAAGG - Intergenic
1120481276 14:85052999-85053021 CATTTTATCTTTAGGAAACATGG + Intergenic
1120624012 14:86802386-86802408 GATTTGAAATCTAGGAAATATGG + Intergenic
1121610679 14:95276666-95276688 CATGTGGTCTCTGGGAAAGATGG - Intronic
1121781993 14:96627925-96627947 AACTTGTTCTCTTGGAAAGGAGG - Intergenic
1126726370 15:51636503-51636525 AATGTGATCTCTGGGCAAGATGG + Intergenic
1127611393 15:60640915-60640937 AATGTGAGCTCCAGGAAAAAAGG + Intronic
1131730524 15:95275268-95275290 AATTGGATCTCAAGGAGAGAAGG + Intergenic
1134502930 16:14783220-14783242 AATTTGATGTATAAGGAAGAAGG + Intronic
1134577634 16:15345676-15345698 AATTTGATGTATAAGGAAGAAGG - Intergenic
1135488301 16:22885300-22885322 AATTTTATCTCTAGGGACTATGG - Intronic
1135580782 16:23624679-23624701 AATTTTATTTTTAGGAGAGACGG + Intronic
1137362170 16:47828578-47828600 AGTTTTAGCTCCAGGAAAGAGGG + Intergenic
1138666851 16:58577417-58577439 AATTGAGTCTCTAGGAAAGGAGG + Intronic
1139208290 16:65050813-65050835 AATTTCATGTCTAGGAAATCTGG - Intronic
1140291448 16:73662624-73662646 AATTTGATTACTATAAAAGATGG + Intergenic
1144175584 17:12703092-12703114 AAAATGACCTCTAGGAATGAAGG - Intronic
1148534520 17:48428719-48428741 TCTTTGGTTTCTAGGAAAGAAGG - Intronic
1149508655 17:57217944-57217966 AAATTGATGACTAAGAAAGAAGG - Intergenic
1149908497 17:60548798-60548820 AATTAGATCTATAGGAAGAAAGG - Intergenic
1151119624 17:71778257-71778279 AAATTTATCTTTAAGAAAGAGGG + Intergenic
1151349671 17:73524388-73524410 AATTTTAGTTCTGGGAAAGAGGG - Intronic
1153202652 18:2661759-2661781 AATTTGACAGCTAGGAAATAGGG + Intronic
1154301245 18:13194631-13194653 AGAATGATCTCTAGGAAGGAAGG + Intergenic
1156604583 18:38651377-38651399 AATTGGATCTCTTTGACAGAAGG + Intergenic
1156724221 18:40108581-40108603 AATTTGCTCTTTTGGAGAGATGG - Intergenic
1159240023 18:65730214-65730236 AATTTTATCTATAGTAAAAATGG - Intergenic
1159272960 18:66176542-66176564 AATCTGATCTCAGGGAAACAGGG + Intergenic
1159307634 18:66664985-66665007 AATTGGATTTCTAGGAAGGGAGG + Intergenic
1159742112 18:72184852-72184874 ATTTTCATCTCAAGGTAAGAGGG + Intergenic
1160471835 18:79142461-79142483 AATTGGATAGCTAGGAGAGAGGG + Intronic
1164006251 19:21152188-21152210 CTTTTGGTCTCTAGGCAAGATGG + Intronic
1164033646 19:21434193-21434215 AAGTTGATCTCCAGGAACTAGGG - Intronic
1164776232 19:30855733-30855755 AAGTTGAATTCTAGGAGAGATGG + Intergenic
1168622844 19:57892857-57892879 AACTTGGTCTCTGGGCAAGATGG - Intronic
929342225 2:40834310-40834332 AAATTGACCTTTAGGAAGGAAGG - Intergenic
930277910 2:49335041-49335063 AATTTTATTTATAGAAAAGAAGG - Intergenic
930330492 2:49977488-49977510 TATTTAATCTTTCGGAAAGAAGG - Intronic
930796917 2:55403086-55403108 AATTTGATTTATAGAAAACATGG - Intronic
930977667 2:57483648-57483670 AATTTGATGTAGAAGAAAGAGGG + Intergenic
931016876 2:57992377-57992399 AATTTGAACAGTAAGAAAGAAGG + Intronic
931278956 2:60771006-60771028 AATGTCATATCTAGGAAATAAGG - Intronic
931823583 2:65976721-65976743 TTTTTGATCTTTAGTAAAGAAGG + Intergenic
933070261 2:77848393-77848415 ATTTTCATCTCAAGGAAAGATGG + Intergenic
934660438 2:96140744-96140766 AATTTAATAAATAGGAAAGAAGG + Intergenic
935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG + Intergenic
935444744 2:103144353-103144375 AATGTGATTTTTAGGAAGGAAGG - Intergenic
936103992 2:109609022-109609044 ATTTTGGTCTGTGGGAAAGAAGG - Intronic
936144279 2:109969171-109969193 GAATTTATCTGTAGGAAAGAAGG + Intergenic
936180961 2:110267131-110267153 GAATTTATCTGTAGGAAAGAAGG + Intergenic
936200410 2:110402298-110402320 GAATTTATCTGTAGGAAAGAAGG - Intergenic
937996295 2:127697305-127697327 AATTTAATCTGTAGGAAATAAGG + Intergenic
938108348 2:128548390-128548412 AAATTGATTTGTAGGAAAGGCGG - Intergenic
938484573 2:131691428-131691450 AATTGGAGCTCTGAGAAAGATGG + Intergenic
939407783 2:141781117-141781139 AATTTGAGTTCTAGGAAAAATGG - Intronic
939692289 2:145279153-145279175 GAGTTTATCTCTAGCAAAGATGG - Intergenic
939786201 2:146516339-146516361 AATTCTATCTCTAGAAAAGAAGG - Intergenic
940176409 2:150882113-150882135 TATTTGAGCTCTATGAAGGAGGG - Intergenic
940558154 2:155258745-155258767 AATTTGATAACTTGGAAAAAAGG + Intergenic
940734339 2:157432194-157432216 ACTTTGATCTCTGGGAATGGAGG - Intronic
941434646 2:165454186-165454208 ATCTTGGTCTCTAGGAAAGATGG - Intergenic
941636435 2:167940034-167940056 CATTTGGTTTCCAGGAAAGATGG + Intergenic
942612904 2:177760560-177760582 AAATTTATCTCTAGGAAGAAAGG - Intronic
943754462 2:191543355-191543377 AATTTGATCTCAAGAGAAGTAGG - Intergenic
943838134 2:192541913-192541935 TGTTTGGTCTCTAAGAAAGATGG + Intergenic
943846674 2:192657885-192657907 AATTTGATCGATGTGAAAGAGGG - Intergenic
944935712 2:204565162-204565184 CAGGTGACCTCTAGGAAAGAAGG - Intronic
944966198 2:204936878-204936900 AATTTGATATATAAGAAAGATGG + Intronic
946265073 2:218533480-218533502 AATTTGATGTGGAGGAGAGAAGG - Intronic
947211791 2:227715394-227715416 AATTTTATTTTTAGTAAAGATGG + Intronic
947283030 2:228477534-228477556 GATTTTATATCTAGGAAAAAGGG + Intergenic
947737098 2:232461246-232461268 ATTTTGGTCTTTAGGAAGGAGGG + Intergenic
1170147925 20:13197793-13197815 AATTTGAACTCTAGGCAATCTGG - Intergenic
1177620664 21:23588151-23588173 AAGTTGATCTCAAAGAAGGAAGG - Intergenic
1177789205 21:25704018-25704040 AATTTGACATCTATGAAGGAAGG - Intronic
1178159335 21:29893811-29893833 TCTTTGAGCTCTAGGAGAGATGG - Intronic
1178440318 21:32593222-32593244 AATTTGACCTCTGGGATAGCTGG + Intronic
949548187 3:5090563-5090585 TGTTTGATCTCTAGGAGTGATGG - Intergenic
950977240 3:17261190-17261212 AATTTTATCTCTATTAAATAAGG + Intronic
951515372 3:23553137-23553159 AATTTTATCTTTAGGTAAGTAGG - Intronic
951847551 3:27101117-27101139 CATTTGGTCTCTAAGACAGATGG - Intergenic
951945644 3:28132790-28132812 AATTTGCTCACCTGGAAAGAAGG + Intergenic
952563779 3:34630156-34630178 AATTGCATCAGTAGGAAAGACGG + Intergenic
953079069 3:39598458-39598480 TATTGGAGCTCTGGGAAAGAGGG - Intergenic
953719250 3:45340931-45340953 CCTTTGGTCTCTTGGAAAGATGG - Intergenic
953730913 3:45447290-45447312 AACTTAACCTCTAGGAAACATGG + Intronic
955198132 3:56824710-56824732 CATTTTATCTTTAGGAAAGAAGG - Intronic
955973958 3:64463089-64463111 AATTGGATCTTTAGGAAGGAGGG + Intergenic
956658147 3:71572681-71572703 AAAGTAACCTCTAGGAAAGAAGG + Intronic
956806170 3:72813903-72813925 AAACTGATTTCTAGGAAAAAAGG + Intronic
957619941 3:82583725-82583747 AATTTGATCTCTCTTAAACAGGG - Intergenic
957812113 3:85236409-85236431 AATTAACTCTCTAGCAAAGAAGG - Intronic
958134604 3:89472151-89472173 AATTTAATCACTAGCAAAAATGG - Intronic
958738030 3:98032544-98032566 AATTTCTTCTCTAGGTAAAAGGG + Intronic
960386618 3:117028358-117028380 CATGTGGTCTCTAGGCAAGATGG - Intronic
960505323 3:118486777-118486799 AATTTGATGTCTAGCTAAAACGG + Intergenic
961074017 3:123964771-123964793 AATTTAATCTCTATGAAAGCAGG + Intergenic
961491548 3:127259839-127259861 GATTTGATCACTACGGAAGAAGG - Intergenic
961863693 3:129938182-129938204 AATTTGAGCTTTAGGAAGGCAGG + Intergenic
962787567 3:138782400-138782422 AATTTAATCACTAAGGAAGAAGG + Intronic
962888139 3:139647044-139647066 GGTTTGATCTGCAGGAAAGAAGG + Intronic
962914790 3:139891079-139891101 AATTTGATTTCTAGTCAACATGG - Intergenic
963641968 3:147872180-147872202 AATTATATCTCTAGACAAGATGG - Intergenic
963649815 3:147964534-147964556 AATTTACTCTCTACGATAGACGG + Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964019192 3:151986564-151986586 AATTTCCTCCCTAGTAAAGATGG - Intergenic
965140396 3:164826047-164826069 TAATTCATCTCTAGGAAGGATGG + Intergenic
965676615 3:171204162-171204184 ATTCTGATCTCTCGGAAACAAGG - Intronic
965684277 3:171285013-171285035 ACTTAGTTCTCAAGGAAAGAAGG - Intronic
965828214 3:172751700-172751722 AATTTTATCTCTGGGATAAAAGG + Intronic
965905299 3:173698260-173698282 AATTAGAAATCCAGGAAAGAAGG + Intronic
967470579 3:189857175-189857197 AAATAGATCAATAGGAAAGAGGG + Intronic
969905084 4:10386380-10386402 ACCTTGCTCTCTGGGAAAGAAGG + Intergenic
970730321 4:19095726-19095748 AATTTCATCTCTATGAAGTAGGG - Intergenic
971252078 4:24981342-24981364 ACTCTAATCTCTAGCAAAGAAGG + Intergenic
971486414 4:27165088-27165110 AAGTATATCTCTAGGATAGATGG + Intergenic
972508674 4:39746242-39746264 AATGTGAGCTCTATGAAAGCAGG - Intronic
973181353 4:47272582-47272604 ATTTTGATCTATAGAAAGGAGGG + Intronic
974650766 4:64750950-64750972 AATTCCATCTATAGGAAAAATGG + Intergenic
974841615 4:67305938-67305960 AATTTTATTTCTATGTAAGAAGG - Intergenic
975043194 4:69769804-69769826 CATGTGATCTCTGGGAAAGAAGG - Intronic
975392821 4:73839004-73839026 TATTTCATGTCTAGGAAACAGGG - Intronic
976027172 4:80702944-80702966 AGGTTGATCTCTATGAAGGATGG - Intronic
977674455 4:99732460-99732482 CATGTGGTCTCTGGGAAAGATGG + Intergenic
977849696 4:101810981-101811003 TATTTTATCTCTACGAATGAGGG + Intronic
977984959 4:103372390-103372412 AATTTTATCTATAGGAACAATGG + Intergenic
978307828 4:107351484-107351506 AACATGAAGTCTAGGAAAGAGGG + Intergenic
978624237 4:110666397-110666419 CATTTGATCAATAGAAAAGAAGG + Intergenic
978805910 4:112800157-112800179 AATATGAACTCTTGGAGAGAAGG - Intergenic
980879250 4:138692858-138692880 AATTTTATTTGCAGGAAAGAAGG - Intergenic
981880924 4:149611632-149611654 AATTTTATCTCATGGAGAGAGGG + Intergenic
982158698 4:152545581-152545603 CATTTCATCTCTGGGATAGATGG - Intergenic
983276221 4:165621251-165621273 TATTTGAGCTCTAGGGGAGAAGG + Intergenic
983699075 4:170569131-170569153 AGATTGATCTCTAGGATAGGTGG - Intergenic
983750159 4:171258302-171258324 AATTTGTCATCTAGGTAAGATGG - Intergenic
984583994 4:181542056-181542078 AATTTAAGCTCTAGGAGGGAGGG - Intergenic
985923257 5:2996044-2996066 AACTTGATCTAAGGGAAAGATGG - Intergenic
987940733 5:24532339-24532361 AATTTAATATCTAGGAAGCATGG - Intronic
988326374 5:29773886-29773908 ACTTTGATCTCCAGGAAAATAGG - Intergenic
988706579 5:33731925-33731947 AATTTGTTCTTTTGGAGAGATGG + Intronic
988843000 5:35101405-35101427 AATTTGAACTCAAGGGCAGATGG + Intronic
992406250 5:76460421-76460443 AACTTGTTCTGTAGGAAATAGGG + Intronic
993392852 5:87342582-87342604 ACCTTGATCTCTAGCAACGAGGG - Intronic
993961876 5:94307819-94307841 AATTTGTTCTCTTCCAAAGATGG + Intronic
995001862 5:107142431-107142453 AATTTGATCAAGAGAAAAGAAGG - Intergenic
995490423 5:112685196-112685218 ATTCTCATCTCTAGTAAAGATGG - Intergenic
995797585 5:115958175-115958197 AGTGTGCTCTCTAGGTAAGAAGG - Intergenic
998193240 5:140043930-140043952 AATCTGATCTCTAAGAAAGGTGG + Intergenic
1000694340 5:164361239-164361261 AATTGGAGCCATAGGAAAGATGG + Intergenic
1000863213 5:166481619-166481641 ATTTTGTTTTCTAGGACAGAAGG + Intergenic
1001874320 5:175186118-175186140 AATTTGACCTTGAAGAAAGAGGG - Intergenic
1001912906 5:175535721-175535743 AATACTATCTCCAGGAAAGATGG + Intergenic
1002689996 5:181044056-181044078 AATTTTAGCTCTAGGAGACAGGG + Intronic
1003480521 6:6527550-6527572 AATTTGTTCTGTAGCAGAGATGG + Intergenic
1004545537 6:16594985-16595007 AATTGAATGACTAGGAAAGAAGG - Intronic
1004945202 6:20604584-20604606 AATTCCTTCTCTAGCAAAGAAGG + Intronic
1005798654 6:29395367-29395389 AATTTTATCTGATGGAAAGAAGG + Intronic
1007042959 6:38742246-38742268 AAGATGACCTCTAGGAAAGGAGG - Intronic
1007238631 6:40409289-40409311 AATTTGTGCTCTAGTGAAGAAGG + Intronic
1009522077 6:64695292-64695314 AAGTTGACCTCCAGGCAAGAAGG - Intronic
1010719272 6:79263883-79263905 CATGTGATCTCTGGGCAAGATGG + Intergenic
1011666831 6:89642332-89642354 AGTTTGAGGTCTAAGAAAGATGG + Intergenic
1014184241 6:118417242-118417264 AATTTGTTCTCTGGCAAACATGG - Intergenic
1017458761 6:154628743-154628765 CATTGGATCTCTAGATAAGAAGG + Intergenic
1018089672 6:160334721-160334743 AATGTGCTCTGTAGGATAGAAGG - Intergenic
1020917501 7:14214406-14214428 AATTTAATGTTTAGGAAATAAGG + Intronic
1022725194 7:32975013-32975035 AATTTCATTTGGAGGAAAGAGGG + Intronic
1022942636 7:35254642-35254664 AATTTGATCTCTTTGACAGTGGG + Intergenic
1023587866 7:41749988-41750010 CATGTGATCTCTGGGCAAGATGG + Intergenic
1023700455 7:42887481-42887503 AATATTATCTAAAGGAAAGAAGG + Intergenic
1023712270 7:43007362-43007384 AATTTTTTTTCTAGTAAAGAAGG + Intergenic
1025048407 7:55712832-55712854 AATTTCATTTGGAGGAAAGAGGG - Intergenic
1025264625 7:57446199-57446221 CATGTGGTCTCTGGGAAAGATGG - Intergenic
1025740865 7:64194377-64194399 CATGTGGTCTCTGGGAAAGATGG - Intronic
1025741761 7:64203443-64203465 CATGTGATCTCTGGGCAAGATGG + Intronic
1026029396 7:66776772-66776794 AATTTTATCTCTACGAAAAAGGG + Intronic
1026666440 7:72343859-72343881 AATCTGGTTTCTGGGAAAGATGG + Intronic
1027124091 7:75543644-75543666 AATTTGAACACTAATAAAGAGGG + Intronic
1027585713 7:80056111-80056133 AATTTTATCACTAGGAAAAATGG + Intergenic
1027691375 7:81350163-81350185 AATTTTATTTCTCAGAAAGAGGG + Intergenic
1029094949 7:98077634-98077656 ATTTGGATCTCTAGGAAGGCTGG + Intergenic
1030399893 7:109035573-109035595 AATTTGATATCAGGGAAAGAGGG - Intergenic
1031313791 7:120231976-120231998 AAATAAATATCTAGGAAAGAAGG - Intergenic
1031550809 7:123109761-123109783 GGTTAGATCTCCAGGAAAGAGGG + Intergenic
1034136743 7:148777893-148777915 AATTTTATCTTTAGTAGAGACGG - Intronic
1036980529 8:13465216-13465238 ATTTTGTTCTCCAGGAAAGGTGG - Intronic
1037121694 8:15295529-15295551 AATTGGATTTCTAGGTAATAGGG + Intergenic
1037856570 8:22375432-22375454 ATTTTGATGTCGAGGTAAGATGG - Intronic
1039542665 8:38384092-38384114 AATTCTATCTCCAGGAAAGAGGG + Intergenic
1040918873 8:52594335-52594357 AATTTGACATCTAGGAATGCTGG - Intergenic
1041586276 8:59523620-59523642 AACTTTATCTCAAGGACAGAGGG - Intergenic
1044275838 8:90298296-90298318 ATTTACATCTCTAGCAAAGAGGG - Intergenic
1045155938 8:99471190-99471212 AATTAGATCTTTAGGAATGAAGG + Intronic
1045735450 8:105290999-105291021 ACTTGGATTTTTAGGAAAGAAGG + Intronic
1047645459 8:126865415-126865437 CTTTTGGTATCTAGGAAAGAAGG - Intergenic
1047886296 8:129253683-129253705 TTTTCGCTCTCTAGGAAAGAGGG + Intergenic
1047917004 8:129593430-129593452 ATCTGGAACTCTAGGAAAGAGGG + Intergenic
1049291599 8:141805938-141805960 AATTTGATGACTATGAAAGATGG - Intergenic
1050139205 9:2499952-2499974 AATGTGATCTTTAGAAAAGAGGG + Intergenic
1051377929 9:16423204-16423226 ATATTTATCTCTAGGAAAGAGGG + Intronic
1052663757 9:31469064-31469086 CACATGATCTCTAGGCAAGATGG + Intergenic
1055930016 9:81550496-81550518 AATTTTACCTCAATGAAAGAAGG - Intergenic
1058636673 9:107044695-107044717 AAGGTGAGCTCTAGGAGAGAAGG + Intergenic
1059032012 9:110708217-110708239 AATTTGATCTCTAGGAAAGAAGG - Intronic
1203406244 Un_KI270538v1:17044-17066 AAATTGATCTCTCAAAAAGAAGG - Intergenic
1187104366 X:16224784-16224806 ACTTTGATCTCTAAGAGATAGGG - Intergenic
1187657300 X:21491547-21491569 AACTTACTCTCTAGGATAGATGG - Intronic
1190524552 X:51315402-51315424 CATTTGAACTCTGGGAAACATGG + Intergenic
1190586442 X:51948362-51948384 AATTTGATCTCCAGCATTGAAGG + Intergenic
1190747620 X:53334300-53334322 AATGTGAGCTCTAGGAGAGCAGG - Intergenic
1193248478 X:79259441-79259463 AATTTGATCCATATGAAACAAGG + Intergenic
1193349593 X:80445467-80445489 AATTTGCTTTTTAGGAAAGAAGG - Intergenic
1193527726 X:82613508-82613530 AATGGGATATCTAGGAAAAATGG - Intergenic
1193825682 X:86222983-86223005 AGTTTAATATCTAGGGAAGAAGG + Intronic
1194182219 X:90726326-90726348 AATTGGATAACTCGGAAAGATGG + Intergenic
1195646312 X:107234556-107234578 CATTTGATTCTTAGGAAAGAAGG - Intronic
1197326939 X:125105857-125105879 AATTTGATTCCAAGGAAAGTGGG - Intergenic
1197402704 X:126011180-126011202 AATTTTATCTCTAGAAAACAGGG + Intergenic
1197650022 X:129054123-129054145 AATTTGATTCCAAGGAAAGTGGG - Intergenic
1200528850 Y:4308287-4308309 AATTGGATAACTCGGAAAGATGG + Intergenic