ID: 1059037184

View in Genome Browser
Species Human (GRCh38)
Location 9:110767250-110767272
Sequence AAAAAGAAAGTGATGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059037184_1059037189 10 Left 1059037184 9:110767250-110767272 CCTCCCTACATCACTTTCTTTTT No data
Right 1059037189 9:110767283-110767305 ATTCTAGGAAGATGTGTGAGTGG No data
1059037184_1059037191 26 Left 1059037184 9:110767250-110767272 CCTCCCTACATCACTTTCTTTTT No data
Right 1059037191 9:110767299-110767321 TGAGTGGGAGAATCTGAGTGTGG No data
1059037184_1059037188 -5 Left 1059037184 9:110767250-110767272 CCTCCCTACATCACTTTCTTTTT No data
Right 1059037188 9:110767268-110767290 TTTTTCTTTAATGGAATTCTAGG No data
1059037184_1059037192 30 Left 1059037184 9:110767250-110767272 CCTCCCTACATCACTTTCTTTTT No data
Right 1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG No data
1059037184_1059037190 11 Left 1059037184 9:110767250-110767272 CCTCCCTACATCACTTTCTTTTT No data
Right 1059037190 9:110767284-110767306 TTCTAGGAAGATGTGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059037184 Original CRISPR AAAAAGAAAGTGATGTAGGG AGG (reversed) Intronic