ID: 1059037185

View in Genome Browser
Species Human (GRCh38)
Location 9:110767253-110767275
Sequence AAGAAAAAGAAAGTGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059037185_1059037189 7 Left 1059037185 9:110767253-110767275 CCCTACATCACTTTCTTTTTCTT No data
Right 1059037189 9:110767283-110767305 ATTCTAGGAAGATGTGTGAGTGG No data
1059037185_1059037192 27 Left 1059037185 9:110767253-110767275 CCCTACATCACTTTCTTTTTCTT No data
Right 1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG No data
1059037185_1059037188 -8 Left 1059037185 9:110767253-110767275 CCCTACATCACTTTCTTTTTCTT No data
Right 1059037188 9:110767268-110767290 TTTTTCTTTAATGGAATTCTAGG No data
1059037185_1059037191 23 Left 1059037185 9:110767253-110767275 CCCTACATCACTTTCTTTTTCTT No data
Right 1059037191 9:110767299-110767321 TGAGTGGGAGAATCTGAGTGTGG No data
1059037185_1059037190 8 Left 1059037185 9:110767253-110767275 CCCTACATCACTTTCTTTTTCTT No data
Right 1059037190 9:110767284-110767306 TTCTAGGAAGATGTGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059037185 Original CRISPR AAGAAAAAGAAAGTGATGTA GGG (reversed) Intronic