ID: 1059037188

View in Genome Browser
Species Human (GRCh38)
Location 9:110767268-110767290
Sequence TTTTTCTTTAATGGAATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059037182_1059037188 22 Left 1059037182 9:110767223-110767245 CCTCTGGAAGCCATATTTCTGCT No data
Right 1059037188 9:110767268-110767290 TTTTTCTTTAATGGAATTCTAGG No data
1059037184_1059037188 -5 Left 1059037184 9:110767250-110767272 CCTCCCTACATCACTTTCTTTTT No data
Right 1059037188 9:110767268-110767290 TTTTTCTTTAATGGAATTCTAGG No data
1059037185_1059037188 -8 Left 1059037185 9:110767253-110767275 CCCTACATCACTTTCTTTTTCTT No data
Right 1059037188 9:110767268-110767290 TTTTTCTTTAATGGAATTCTAGG No data
1059037183_1059037188 12 Left 1059037183 9:110767233-110767255 CCATATTTCTGCTTTCTCCTCCC No data
Right 1059037188 9:110767268-110767290 TTTTTCTTTAATGGAATTCTAGG No data
1059037186_1059037188 -9 Left 1059037186 9:110767254-110767276 CCTACATCACTTTCTTTTTCTTT No data
Right 1059037188 9:110767268-110767290 TTTTTCTTTAATGGAATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059037188 Original CRISPR TTTTTCTTTAATGGAATTCT AGG Intronic