ID: 1059037189

View in Genome Browser
Species Human (GRCh38)
Location 9:110767283-110767305
Sequence ATTCTAGGAAGATGTGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059037185_1059037189 7 Left 1059037185 9:110767253-110767275 CCCTACATCACTTTCTTTTTCTT No data
Right 1059037189 9:110767283-110767305 ATTCTAGGAAGATGTGTGAGTGG No data
1059037186_1059037189 6 Left 1059037186 9:110767254-110767276 CCTACATCACTTTCTTTTTCTTT No data
Right 1059037189 9:110767283-110767305 ATTCTAGGAAGATGTGTGAGTGG No data
1059037183_1059037189 27 Left 1059037183 9:110767233-110767255 CCATATTTCTGCTTTCTCCTCCC No data
Right 1059037189 9:110767283-110767305 ATTCTAGGAAGATGTGTGAGTGG No data
1059037184_1059037189 10 Left 1059037184 9:110767250-110767272 CCTCCCTACATCACTTTCTTTTT No data
Right 1059037189 9:110767283-110767305 ATTCTAGGAAGATGTGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059037189 Original CRISPR ATTCTAGGAAGATGTGTGAG TGG Intronic