ID: 1059037191

View in Genome Browser
Species Human (GRCh38)
Location 9:110767299-110767321
Sequence TGAGTGGGAGAATCTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059037186_1059037191 22 Left 1059037186 9:110767254-110767276 CCTACATCACTTTCTTTTTCTTT No data
Right 1059037191 9:110767299-110767321 TGAGTGGGAGAATCTGAGTGTGG No data
1059037185_1059037191 23 Left 1059037185 9:110767253-110767275 CCCTACATCACTTTCTTTTTCTT No data
Right 1059037191 9:110767299-110767321 TGAGTGGGAGAATCTGAGTGTGG No data
1059037184_1059037191 26 Left 1059037184 9:110767250-110767272 CCTCCCTACATCACTTTCTTTTT No data
Right 1059037191 9:110767299-110767321 TGAGTGGGAGAATCTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059037191 Original CRISPR TGAGTGGGAGAATCTGAGTG TGG Intronic