ID: 1059037192

View in Genome Browser
Species Human (GRCh38)
Location 9:110767303-110767325
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059037184_1059037192 30 Left 1059037184 9:110767250-110767272 CCTCCCTACATCACTTTCTTTTT 0: 1
1: 0
2: 6
3: 117
4: 1352
Right 1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG No data
1059037185_1059037192 27 Left 1059037185 9:110767253-110767275 CCCTACATCACTTTCTTTTTCTT 0: 1
1: 2
2: 17
3: 231
4: 1951
Right 1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG No data
1059037186_1059037192 26 Left 1059037186 9:110767254-110767276 CCTACATCACTTTCTTTTTCTTT 0: 1
1: 4
2: 25
3: 429
4: 3676
Right 1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr