ID: 1059040790

View in Genome Browser
Species Human (GRCh38)
Location 9:110813609-110813631
Sequence ATTTGTGATGAGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059040790_1059040793 16 Left 1059040790 9:110813609-110813631 CCTTCCACCTGCTCATCACAAAT No data
Right 1059040793 9:110813648-110813670 GCACTGCTACGACATTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059040790 Original CRISPR ATTTGTGATGAGCAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr