ID: 1059040793

View in Genome Browser
Species Human (GRCh38)
Location 9:110813648-110813670
Sequence GCACTGCTACGACATTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059040791_1059040793 12 Left 1059040791 9:110813613-110813635 CCACCTGCTCATCACAAATAAAT No data
Right 1059040793 9:110813648-110813670 GCACTGCTACGACATTTCAAAGG No data
1059040792_1059040793 9 Left 1059040792 9:110813616-110813638 CCTGCTCATCACAAATAAATTCA No data
Right 1059040793 9:110813648-110813670 GCACTGCTACGACATTTCAAAGG No data
1059040790_1059040793 16 Left 1059040790 9:110813609-110813631 CCTTCCACCTGCTCATCACAAAT No data
Right 1059040793 9:110813648-110813670 GCACTGCTACGACATTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059040793 Original CRISPR GCACTGCTACGACATTTCAA AGG Intergenic
No off target data available for this crispr