ID: 1059043525

View in Genome Browser
Species Human (GRCh38)
Location 9:110840454-110840476
Sequence GGAATCCCATACTGATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059043525_1059043527 -4 Left 1059043525 9:110840454-110840476 CCAAGAAATCAGTATGGGATTCC No data
Right 1059043527 9:110840473-110840495 TTCCTATAGGAATAACCAAATGG No data
1059043525_1059043529 0 Left 1059043525 9:110840454-110840476 CCAAGAAATCAGTATGGGATTCC No data
Right 1059043529 9:110840477-110840499 TATAGGAATAACCAAATGGCAGG No data
1059043525_1059043531 28 Left 1059043525 9:110840454-110840476 CCAAGAAATCAGTATGGGATTCC No data
Right 1059043531 9:110840505-110840527 TATTTAGAAAATATTCTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059043525 Original CRISPR GGAATCCCATACTGATTTCT TGG (reversed) Intergenic