ID: 1059043528

View in Genome Browser
Species Human (GRCh38)
Location 9:110840475-110840497
Sequence TGCCATTTGGTTATTCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059043528_1059043531 7 Left 1059043528 9:110840475-110840497 CCTATAGGAATAACCAAATGGCA No data
Right 1059043531 9:110840505-110840527 TATTTAGAAAATATTCTGTTCGG No data
1059043528_1059043533 22 Left 1059043528 9:110840475-110840497 CCTATAGGAATAACCAAATGGCA No data
Right 1059043533 9:110840520-110840542 CTGTTCGGATGCTAATGAAAGGG No data
1059043528_1059043532 21 Left 1059043528 9:110840475-110840497 CCTATAGGAATAACCAAATGGCA No data
Right 1059043532 9:110840519-110840541 TCTGTTCGGATGCTAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059043528 Original CRISPR TGCCATTTGGTTATTCCTAT AGG (reversed) Intergenic
No off target data available for this crispr