ID: 1059043530

View in Genome Browser
Species Human (GRCh38)
Location 9:110840488-110840510
Sequence TAAATAGCTCTCCTGCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059043530_1059043531 -6 Left 1059043530 9:110840488-110840510 CCAAATGGCAGGAGAGCTATTTA No data
Right 1059043531 9:110840505-110840527 TATTTAGAAAATATTCTGTTCGG No data
1059043530_1059043534 19 Left 1059043530 9:110840488-110840510 CCAAATGGCAGGAGAGCTATTTA No data
Right 1059043534 9:110840530-110840552 GCTAATGAAAGGGAATATACAGG No data
1059043530_1059043533 9 Left 1059043530 9:110840488-110840510 CCAAATGGCAGGAGAGCTATTTA No data
Right 1059043533 9:110840520-110840542 CTGTTCGGATGCTAATGAAAGGG No data
1059043530_1059043532 8 Left 1059043530 9:110840488-110840510 CCAAATGGCAGGAGAGCTATTTA No data
Right 1059043532 9:110840519-110840541 TCTGTTCGGATGCTAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059043530 Original CRISPR TAAATAGCTCTCCTGCCATT TGG (reversed) Intergenic