ID: 1059043531

View in Genome Browser
Species Human (GRCh38)
Location 9:110840505-110840527
Sequence TATTTAGAAAATATTCTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059043525_1059043531 28 Left 1059043525 9:110840454-110840476 CCAAGAAATCAGTATGGGATTCC No data
Right 1059043531 9:110840505-110840527 TATTTAGAAAATATTCTGTTCGG No data
1059043530_1059043531 -6 Left 1059043530 9:110840488-110840510 CCAAATGGCAGGAGAGCTATTTA No data
Right 1059043531 9:110840505-110840527 TATTTAGAAAATATTCTGTTCGG No data
1059043528_1059043531 7 Left 1059043528 9:110840475-110840497 CCTATAGGAATAACCAAATGGCA No data
Right 1059043531 9:110840505-110840527 TATTTAGAAAATATTCTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059043531 Original CRISPR TATTTAGAAAATATTCTGTT CGG Intergenic