ID: 1059044960

View in Genome Browser
Species Human (GRCh38)
Location 9:110856363-110856385
Sequence CCTGTGAAGGAGTAACAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059044960_1059044965 4 Left 1059044960 9:110856363-110856385 CCTGACTGTTACTCCTTCACAGG No data
Right 1059044965 9:110856390-110856412 CTATGTCCTATAGAGTAATCTGG No data
1059044960_1059044967 20 Left 1059044960 9:110856363-110856385 CCTGACTGTTACTCCTTCACAGG No data
Right 1059044967 9:110856406-110856428 AATCTGGATATCTTCCAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059044960 Original CRISPR CCTGTGAAGGAGTAACAGTC AGG (reversed) Intergenic
No off target data available for this crispr