ID: 1059046709

View in Genome Browser
Species Human (GRCh38)
Location 9:110876968-110876990
Sequence CCCATTACACCTCACCTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059046705_1059046709 2 Left 1059046705 9:110876943-110876965 CCAACAGCGGTGGGCACCACTGT 0: 1
1: 0
2: 0
3: 16
4: 135
Right 1059046709 9:110876968-110876990 CCCATTACACCTCACCTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059046709 Original CRISPR CCCATTACACCTCACCTAAT GGG Intronic
No off target data available for this crispr