ID: 1059046710

View in Genome Browser
Species Human (GRCh38)
Location 9:110876969-110876991
Sequence GCCCATTAGGTGAGGTGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059046710_1059046718 18 Left 1059046710 9:110876969-110876991 CCATTACACCTCACCTAATGGGC 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1059046718 9:110877010-110877032 CAGGCTACATATGTGTAATCAGG No data
1059046710_1059046715 -1 Left 1059046710 9:110876969-110876991 CCATTACACCTCACCTAATGGGC 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1059046715 9:110876991-110877013 CCCCATATGTGTAATCAGGCAGG No data
1059046710_1059046719 26 Left 1059046710 9:110876969-110876991 CCATTACACCTCACCTAATGGGC 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1059046719 9:110877018-110877040 ATATGTGTAATCAGGCAGAGCGG No data
1059046710_1059046713 -5 Left 1059046710 9:110876969-110876991 CCATTACACCTCACCTAATGGGC 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1059046713 9:110876987-110877009 TGGGCCCCATATGTGTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059046710 Original CRISPR GCCCATTAGGTGAGGTGTAA TGG (reversed) Intronic
902514375 1:16981972-16981994 GCCCAAGAGGTGAGCTGTGATGG - Intergenic
905284616 1:36871227-36871249 GCCTTTTAAGTGCGGTGTAAAGG + Intronic
906538421 1:46565494-46565516 GCCCATTCAGTGGAGTGTAAAGG + Intronic
907424215 1:54368954-54368976 GGGCATGAGGGGAGGTGTAAAGG + Intronic
910315298 1:85875569-85875591 TCCCTTTAGATGAGGTTTAAAGG - Intronic
910466111 1:87501936-87501958 GCCCACTAGGTGGAGTGAAATGG - Intergenic
914492846 1:148162883-148162905 GCCCACTAGGTGGAGTGAAATGG + Intergenic
916541454 1:165759348-165759370 ACCCATTTTGTGAGGTGTACAGG - Intronic
919139155 1:193548719-193548741 TCTCATTAGGTGAAGAGTAATGG - Intergenic
1063206582 10:3837842-3837864 GCCCATTAGATGAAGTATAATGG + Intergenic
1068920489 10:62478253-62478275 GCCCATTTGGAAAGGTGAAAGGG + Intronic
1087535908 11:99445266-99445288 CCTCATTAGCTGAGGTGAAATGG - Intronic
1088177680 11:107072519-107072541 GGCCATGAGGTGAGTTATAAAGG + Intergenic
1092084353 12:5743316-5743338 GCACATTCGGTGATGAGTAAAGG + Intronic
1102202383 12:111066581-111066603 ACCCATTGGGTGAGGGGTGAGGG + Intronic
1106692958 13:32138725-32138747 GTCCACTATGTGAGGTGTTAGGG + Intronic
1115147295 14:30240160-30240182 ACCCATTAGCTGAGCTGTAATGG - Intergenic
1117076281 14:52108273-52108295 GCTTATTAGGTGAAGTGTAGTGG + Intergenic
1118011443 14:61614576-61614598 GCCCCTTAGGTAAGGTGTCCTGG + Intronic
1118387793 14:65270925-65270947 AGCCAATAGCTGAGGTGTAATGG + Intergenic
1118814926 14:69304612-69304634 GGCTATTGGGGGAGGTGTAAAGG - Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1143649703 17:8255902-8255924 GTCCAATAGGTGAGGAGAAATGG + Exonic
1157415031 18:47495212-47495234 GCCCATTAGGCAGGATGTAAGGG - Intergenic
925183812 2:1833598-1833620 GACCCTCAGGTCAGGTGTAAAGG - Intronic
930839469 2:55829176-55829198 GCCCATTTGGTCAAGTGTCAAGG - Intergenic
931893901 2:66707251-66707273 GCCCATGAGGTGAGGAGCAGAGG + Intergenic
933682730 2:85117341-85117363 GCCCAAGGGGTCAGGTGTAAAGG + Intergenic
938569263 2:132547134-132547156 GCCCATTAGCTCAGATGGAATGG + Intronic
942226141 2:173817886-173817908 GCCAATTAGCTGAGGTGGAAAGG - Intergenic
942252610 2:174060236-174060258 GCCCAGGAGGTGAGCTGTGATGG + Intergenic
945338466 2:208620262-208620284 CCCCATTAGGGGAGGGATAAAGG + Intronic
946695046 2:222347870-222347892 GGTCATTTGGTGAGGTGTTAGGG + Intergenic
1180634945 22:17256833-17256855 GCCCCTTAGGTGGGGTGTGTTGG - Intergenic
1182578347 22:31289120-31289142 GGCTTTTAAGTGAGGTGTAAAGG + Intronic
955558464 3:60163352-60163374 TCACATTAGGTGAGATGTAAGGG - Intronic
955780940 3:62483577-62483599 TCCCAAAATGTGAGGTGTAAAGG - Intronic
961193700 3:124983829-124983851 GACTATTTGGTGAGGTGGAAGGG - Intronic
961980591 3:131073973-131073995 GCCCAAAGGGTGAGGAGTAATGG - Intronic
965512263 3:169581373-169581395 GCCCATTAGGTAGGGTTTGATGG - Intronic
966223150 3:177570350-177570372 GCCCATTATGTGAGTTGTTGGGG - Intergenic
966334798 3:178856139-178856161 GCCCATTGGGTGATGGGGAATGG - Intergenic
976879734 4:89905550-89905572 GGGTATTAGGTGAGGTGTGAGGG + Intronic
977169546 4:93743754-93743776 TCCCATTAGGTGGGGCCTAATGG - Intronic
979015492 4:115427331-115427353 CACAATTAGGTGAGGTGTCATGG + Intergenic
983558757 4:169080785-169080807 GCACAGTAGGTGAGGTGATATGG + Intergenic
994584571 5:101690298-101690320 ACACAATAGGTGATGTGTAAAGG - Intergenic
999096390 5:148981588-148981610 GCCCATTAGGGGAACTGGAATGG + Intronic
1022637057 7:32146200-32146222 GCACATTAGGTGGGGTGTTCTGG - Intronic
1024200166 7:47098233-47098255 GCCCATGAGGTGAGAGGTGAGGG + Intergenic
1025640822 7:63366576-63366598 GGCAACTAGGTGAGGTGTGAGGG + Intergenic
1031262758 7:119543223-119543245 GCCCAGTAGGCTAGGTGTCATGG + Intergenic
1034921963 7:155090789-155090811 TCACATTAGGTGATGTGTAAAGG - Intergenic
1039797506 8:40927738-40927760 GTCCATGCGGTGAGATGTAAGGG - Intergenic
1057934869 9:99228540-99228562 GCTCATTAGGTGATGGGAAATGG + Intronic
1058198443 9:102008482-102008504 TCCCATTAGGTGAGGGGGATGGG - Intergenic
1059046710 9:110876969-110876991 GCCCATTAGGTGAGGTGTAATGG - Intronic
1059827420 9:118046696-118046718 TTCCATAAGGTAAGGTGTAAAGG - Intergenic
1188116270 X:26247499-26247521 GCCCATGAGGTGAGGGGCAAAGG + Intergenic
1190335209 X:49257965-49257987 GCCAAGTAGGTGAGGTGACAGGG - Intronic