ID: 1059047272

View in Genome Browser
Species Human (GRCh38)
Location 9:110882539-110882561
Sequence CAATTCCTACACACTTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059047267_1059047272 8 Left 1059047267 9:110882508-110882530 CCCTGGAAGACCAAATTCTAGAA 0: 1
1: 0
2: 2
3: 17
4: 272
Right 1059047272 9:110882539-110882561 CAATTCCTACACACTTTTGAAGG No data
1059047271_1059047272 -2 Left 1059047271 9:110882518-110882540 CCAAATTCTAGAATGGTGGAACA 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1059047272 9:110882539-110882561 CAATTCCTACACACTTTTGAAGG No data
1059047268_1059047272 7 Left 1059047268 9:110882509-110882531 CCTGGAAGACCAAATTCTAGAAT 0: 1
1: 0
2: 3
3: 11
4: 181
Right 1059047272 9:110882539-110882561 CAATTCCTACACACTTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059047272 Original CRISPR CAATTCCTACACACTTTTGA AGG Intronic
No off target data available for this crispr