ID: 1059049993

View in Genome Browser
Species Human (GRCh38)
Location 9:110914019-110914041
Sequence ACCAAAGGAAAAAAGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 880
Summary {0: 1, 1: 0, 2: 2, 3: 72, 4: 805}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059049993_1059049998 11 Left 1059049993 9:110914019-110914041 CCTCATTGCTTTTTTCCTTTGGT 0: 1
1: 0
2: 2
3: 72
4: 805
Right 1059049998 9:110914053-110914075 AAGGATGACAGCATCTCAAAAGG No data
1059049993_1059049999 25 Left 1059049993 9:110914019-110914041 CCTCATTGCTTTTTTCCTTTGGT 0: 1
1: 0
2: 2
3: 72
4: 805
Right 1059049999 9:110914067-110914089 CTCAAAAGGCAACTCTTCCCAGG No data
1059049993_1059049995 -8 Left 1059049993 9:110914019-110914041 CCTCATTGCTTTTTTCCTTTGGT 0: 1
1: 0
2: 2
3: 72
4: 805
Right 1059049995 9:110914034-110914056 CCTTTGGTTCCTGTCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059049993 Original CRISPR ACCAAAGGAAAAAAGCAATG AGG (reversed) Intronic
900766529 1:4509646-4509668 AGCAAAGGCAAAAAGCAGAGAGG - Intergenic
901386217 1:8911031-8911053 AACAAAACAAAAAACCAATGAGG + Intergenic
902590599 1:17471616-17471638 AAAAAAGAAAAAAAGAAATGAGG - Intergenic
903244213 1:22004041-22004063 AAGAAAAGAAAAAAGCACTGAGG - Intronic
903449839 1:23445491-23445513 TCCAAAAAAAAAAAGGAATGAGG + Intronic
903454289 1:23476360-23476382 AAAAAAGAAAAAAAGAAATGTGG + Intronic
904080231 1:27867902-27867924 AACAAAAGAAAAAAGCCAAGAGG + Intergenic
905040992 1:34958245-34958267 ATAAAAGAAAAAAAGCAATATGG + Intergenic
905712010 1:40113176-40113198 ATCTAACAAAAAAAGCAATGGGG + Intergenic
905762885 1:40575120-40575142 AAAAAAGGAAAAAAGAAAAGAGG - Intergenic
906044191 1:42815400-42815422 CTCAAAAAAAAAAAGCAATGTGG + Intronic
906095689 1:43222544-43222566 ACCAAAGGAGAACAGGGATGGGG + Intronic
906155689 1:43612724-43612746 AACAAACGAAAAAAACAACGGGG - Intronic
906182520 1:43834317-43834339 TACAAAGGAACAAAGAAATGGGG - Intronic
906250540 1:44307657-44307679 ACAAAGGTAAAAAAGCAGTGGGG + Intronic
906287076 1:44594516-44594538 GACAAAGGAAAAGAGCAATTTGG - Intronic
906304793 1:44710233-44710255 ACCGAAGGAAACTAACAATGAGG - Intronic
906443144 1:45868539-45868561 AGCAAAGGCAAAAAGCAAGCAGG - Intronic
906897335 1:49790056-49790078 ACCTGACAAAAAAAGCAATGGGG + Intronic
907643667 1:56218763-56218785 GTCAAAGGAAATAAGTAATGTGG + Intergenic
908230965 1:62104586-62104608 AACAAACAAAAAAAGAAATGTGG + Intronic
908254150 1:62288774-62288796 TCCAAATGAAAAAAGAGATGTGG - Intronic
908482089 1:64551217-64551239 AGCAAAGGAAAAAAAAAAAGAGG - Intronic
908668055 1:66514359-66514381 ACCACTGTAAAAAAACAATGTGG + Intergenic
908735865 1:67276294-67276316 ACCTGACAAAAAAAGCAATGGGG + Intergenic
909499638 1:76319819-76319841 AACAAAGGATGAAATCAATGAGG - Intronic
909898825 1:81108540-81108562 AAAAAAAGAAAAAAGAAATGTGG - Intergenic
910001276 1:82345128-82345150 CTCAAAAGAAAAAAGAAATGGGG + Intergenic
910285340 1:85547511-85547533 GGCAAAGGACAAAATCAATGTGG - Intronic
910304126 1:85742122-85742144 AAAAAAAGAAAAAAGAAATGAGG - Intronic
910908506 1:92208755-92208777 AACAACTGAAAACAGCAATGAGG - Intergenic
911410575 1:97501145-97501167 AACAAAGGAAAAAATCAATATGG + Intronic
911754800 1:101541122-101541144 AACAATGGAAAAGAGTAATGAGG + Intergenic
911773105 1:101772633-101772655 ACCAAAGTCAATAAGCAAAGAGG - Intergenic
912133934 1:106636525-106636547 AGAAAAGGAAAAAAGCACTTTGG + Intergenic
913187038 1:116378250-116378272 CACAAAGGAACAAAGGAATGAGG - Intronic
913362538 1:117998319-117998341 ACCAACAAAAACAAGCAATGAGG - Intronic
914001444 1:143698245-143698267 CCCAAACGAAAAAGGCAAAGAGG - Intergenic
915011508 1:152691084-152691106 ACCTGACCAAAAAAGCAATGGGG + Intergenic
915059868 1:153172469-153172491 GCCAAAGGAAAGGTGCAATGAGG - Intergenic
915307140 1:154987029-154987051 ACCAAAGGAAAAAAAAAAAAGGG - Intronic
916190147 1:162170457-162170479 ACCTAATGAAAGAAGCCATGTGG - Intronic
916362611 1:163987952-163987974 ACCAACAGAAAAAAGAAAAGAGG + Intergenic
917208428 1:172603582-172603604 AGAAAAAGAAAAAAGCAAGGAGG - Intronic
917248119 1:173026649-173026671 ACCAACAAAGAAAAGCAATGCGG - Intergenic
917528604 1:175812191-175812213 ACCTGACAAAAAAAGCAATGGGG + Intergenic
917693767 1:177496493-177496515 ACAAAATGAAAAATGCAATAGGG + Intergenic
917928073 1:179805601-179805623 AAGAAAGGAGAAAAACAATGCGG - Intronic
918034065 1:180848932-180848954 ACCAAAGGAGAAAAGCCATGTGG + Intronic
918799657 1:188956101-188956123 ACCAAGAGAAAAGAGCAAGGAGG + Intergenic
919264362 1:195242288-195242310 AACAATGGAAAAAAGAAGTGGGG - Intergenic
919268441 1:195305209-195305231 ATAAAAGGAAAAAAAAAATGAGG + Intergenic
919354635 1:196505349-196505371 ACCTGAGAAAACAAGCAATGGGG - Intronic
919511280 1:198467864-198467886 AACAAAGGAAAAAAGCCTTTGGG + Intergenic
919560623 1:199114264-199114286 ACCAAAGGGTAAAAGCAGTCAGG + Intergenic
920107378 1:203563557-203563579 AACAAAGGAGAAAACCAAAGGGG + Intergenic
920147513 1:203874812-203874834 AAAAAAGAAAAAAAGAAATGGGG - Intergenic
920557427 1:206914283-206914305 AGAAAAAGAAAAAAGAAATGAGG - Intronic
921292918 1:213675508-213675530 ACCAACAAAAATAAGCAATGGGG - Intergenic
921351126 1:214236179-214236201 TCCAAAGGAAAAAGGCAGTGAGG - Intergenic
921396019 1:214670398-214670420 ACAAAGGGAACAAAGCATTGTGG - Intergenic
921494466 1:215821707-215821729 ACCAATAGAAGAAAGCATTGGGG - Intronic
921595628 1:217051039-217051061 ACAAAGGGAAAAAAGAAATCGGG + Intronic
921632438 1:217452019-217452041 ACGAATGGAAAAGAGCACTGCGG + Intronic
922029331 1:221782854-221782876 ACAAAAAGAAAAAAAAAATGAGG - Intergenic
922543638 1:226437450-226437472 AGGAAAGGGAAAAATCAATGAGG - Intergenic
923266213 1:232316674-232316696 ACCAAAATAGAAAAGCAATCTGG - Intergenic
924102363 1:240617861-240617883 ACCCCAGAAAAAAAGCAAGGAGG - Intergenic
924122194 1:240812422-240812444 AAAAAAAGAAAAAAGAAATGTGG - Intronic
924236683 1:242004956-242004978 ACAAAAGGAAAAAAGAAAATGGG - Intergenic
924296463 1:242591799-242591821 ACAAAAACAAACAAGCAATGGGG + Intergenic
924876178 1:248106840-248106862 ACCAGACAAAACAAGCAATGGGG - Intergenic
924884106 1:248193826-248193848 ACCTGACAAAAAAAGCAATGGGG + Intergenic
1063218748 10:3946927-3946949 AGGAAAGAAAAAAAGCAAGGAGG - Intergenic
1064087765 10:12358233-12358255 AAGAAAAGAAAAAAGAAATGAGG + Intronic
1064087812 10:12358537-12358559 AATAAAAGAAAAAAGAAATGGGG + Intronic
1065958636 10:30715281-30715303 AAAAAAGAAAAAAAGAAATGAGG + Intergenic
1066153291 10:32648092-32648114 ACCAACAAAAACAAGCAATGAGG - Intronic
1066197446 10:33114965-33114987 ACCAATTTAATAAAGCAATGTGG + Intergenic
1066590682 10:36990627-36990649 TCCAAAAGAAAAAAAAAATGAGG + Intergenic
1067570999 10:47370835-47370857 ACCAAAGGAAAAACCCCAGGAGG + Intronic
1067914993 10:50387641-50387663 GTCAAATGAAAAAAGCAAGGCGG + Intronic
1068059497 10:52049669-52049691 AACAAGGGAAAAAAACAATGGGG + Intronic
1068480163 10:57579541-57579563 ACCAGAGGAACTAAGCAATTGGG + Intergenic
1068510339 10:57957863-57957885 GCCAGAGGCAGAAAGCAATGGGG + Intergenic
1068719372 10:60225812-60225834 ACAAAAGGAGACAAGCAACGAGG - Intronic
1069657765 10:70102735-70102757 AAGAAAAGAAAAAAGTAATGGGG + Intronic
1069684014 10:70305637-70305659 TCCAAAGGAAAAAAGGAGGGGGG - Intronic
1070175611 10:73966908-73966930 AAAAAAAGAAAAAAGAAATGAGG + Intergenic
1071283742 10:84125579-84125601 ACCAAGGTAAGAAAGCCATGGGG - Intergenic
1071362452 10:84863051-84863073 ACCAAAAAAAAAATGCTATGTGG - Intergenic
1072172090 10:92874073-92874095 AAAAAAGGAAAAAAGAAATTTGG + Intronic
1072481989 10:95817944-95817966 ACCAACTGAAAAAATGAATGAGG + Intronic
1072712130 10:97722711-97722733 ATAAAAGGAATAAAGGAATGAGG - Intergenic
1072961401 10:99932701-99932723 ACCAGAGGAAACAAGCAGTGTGG + Intronic
1072964927 10:99963660-99963682 ACCAGAGGAAACAAGCAGTGTGG - Intronic
1073161909 10:101405251-101405273 AGGAAAAAAAAAAAGCAATGAGG + Intronic
1074421376 10:113311788-113311810 ACTTAAGGAAAAAAGGAATTTGG - Intergenic
1074872492 10:117588129-117588151 ACAAAAGGAAAAAGGCAGGGAGG - Intergenic
1076006261 10:126950052-126950074 ACAAATGGAAAAAAAAAATGAGG - Intronic
1076038079 10:127217952-127217974 AAAAAAAGAAAAAAGCAATGGGG - Intronic
1077221170 11:1417283-1417305 ACCAAAGCAAAAAAGGGAGGTGG - Intronic
1077844023 11:6005253-6005275 ATCAAAGGACAAAAAAAATGAGG + Intergenic
1077924466 11:6667051-6667073 AGCAAAGAGAAAAAGGAATGGGG - Intergenic
1078039706 11:7848601-7848623 ACCATACGAAAAAAAAAATGTGG - Intergenic
1078841720 11:15082761-15082783 ACCCAAGAAAGAAAGCAAGGAGG - Intergenic
1079545199 11:21625536-21625558 ACCAAAGCAAATAAGCCATCTGG - Intergenic
1079876009 11:25858174-25858196 ACCAAAAGAAAAAAGAAAGCAGG - Intergenic
1080121239 11:28680379-28680401 AACAAAGGATAAAAGCTTTGAGG + Intergenic
1080630989 11:34075454-34075476 AGGAAAGAAAAAAAGGAATGTGG + Intronic
1080687930 11:34530921-34530943 CCCAAAGGAGAAGAGCAATAGGG + Intergenic
1080755231 11:35190975-35190997 ACCATAGAAGAAAAGCAAAGAGG - Intronic
1081402640 11:42661217-42661239 CCCAAAGAAAAAAAGTCATGAGG + Intergenic
1081532161 11:43969579-43969601 ACCACAGGGAAAAAGGAAGGAGG - Intergenic
1082267210 11:50131839-50131861 ACCAAGGGCAAAATGCACTGCGG - Intergenic
1082288878 11:50346729-50346751 ACCAAGGGCAAAATGCACTGCGG + Intergenic
1082680927 11:56169041-56169063 ACCAACAAAAACAAGCAATGAGG + Intergenic
1082753318 11:57046028-57046050 ACCTGATAAAAAAAGCAATGGGG + Intergenic
1082927214 11:58562658-58562680 GCCAAAGGGAAAAAGAAAAGAGG + Intronic
1084837867 11:71817266-71817288 ACCAAAGGGAAAAATCAAGCTGG + Intergenic
1085897619 11:80658794-80658816 TCCAAAAGAAAAAAAAAATGAGG - Intergenic
1086041272 11:82482334-82482356 ACCAGACAAAACAAGCAATGGGG - Intergenic
1086052089 11:82604204-82604226 ACCAAAGCATAAAAGTAACGAGG + Intergenic
1086547039 11:88009665-88009687 ACCAAAGGAGTAAAACAATTAGG + Intergenic
1087446487 11:98260930-98260952 ATCAACGAAAAAAAGAAATGGGG - Intergenic
1087699099 11:101415021-101415043 AACAAAAGAAAAAAGTAATATGG - Intergenic
1087741907 11:101897620-101897642 ACCTGACAAAAAAAGCAATGGGG - Intronic
1088243104 11:107791037-107791059 AACAATGTAAAAAAGAAATGGGG - Exonic
1088325605 11:108597734-108597756 AGGGAAGGAAAAAAACAATGTGG + Intergenic
1088342257 11:108781739-108781761 AAGAAAGGAAACAAACAATGGGG - Intronic
1088615736 11:111625795-111625817 AAAAAGGGAAAAAAGAAATGAGG + Intronic
1088868037 11:113867784-113867806 ACAAAAGGAAAGAAGGAAGGGGG + Intronic
1089005987 11:115091189-115091211 AAGAAAGAAAAAACGCAATGGGG - Intergenic
1089392175 11:118109644-118109666 AGAAAAGAAAACAAGCAATGTGG + Intronic
1089645780 11:119877852-119877874 CTCAGAGGCAAAAAGCAATGAGG - Intergenic
1090011418 11:123049015-123049037 AAAAAAGTAAAAAAGAAATGGGG - Intergenic
1090297094 11:125598221-125598243 AGAAAAAGAAAAAAGAAATGAGG + Intronic
1091085319 11:132716079-132716101 ACCAAAGGAAAGAAAGAAGGAGG + Intronic
1091462319 12:653685-653707 ACCAAAGGCAAAAAAAAAAGTGG + Intronic
1091541281 12:1464981-1465003 CACAAAGGAAAAAAGCAATTAGG - Intronic
1091851451 12:3701113-3701135 GCCAAAGAAAAAAAGGAAAGGGG + Intronic
1092143069 12:6197383-6197405 GCCAAAGGAAAAAATCAAGCTGG - Intergenic
1092738274 12:11604715-11604737 AGCAAAGGAAAAAAGGATTTGGG + Intergenic
1092799091 12:12145603-12145625 AGAAAAAGAAAAAAGAAATGTGG - Intronic
1093403143 12:18771769-18771791 ACCAACACAAACAAGCAATGGGG - Intergenic
1093498297 12:19781933-19781955 ACCAACAAAAACAAGCAATGAGG + Intergenic
1093544609 12:20331904-20331926 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1093545945 12:20348172-20348194 ATCAATGAAAATAAGCAATGGGG + Intergenic
1093940865 12:25052444-25052466 AACAAAAAAAAAAAGCAAAGAGG + Intronic
1094052294 12:26234015-26234037 TCCAAAGAAAAAAAACAGTGAGG - Intronic
1094318006 12:29153351-29153373 AACAAAGAGAAAAAGCAATCTGG + Intronic
1094326007 12:29239980-29240002 AACATAGGATAAAAGTAATGTGG - Intronic
1095236009 12:39796448-39796470 AACAAACAAAAAAAGAAATGAGG + Intronic
1095345393 12:41143472-41143494 AAAAAAGAAAAAAAGAAATGTGG - Intergenic
1095512233 12:42964948-42964970 ACCAAAGGAAATGAGCAGAGAGG - Intergenic
1095668551 12:44832092-44832114 AGAAAAGAAAAAAAGCAATATGG - Intronic
1095715541 12:45342408-45342430 ACCAGATGACAAAAGGAATGAGG - Intronic
1096036042 12:48471607-48471629 ACCAAGAAAAACAAGCAATGGGG - Intergenic
1096298274 12:50402381-50402403 GCCTAAGGAAAACAACAATGAGG - Intronic
1096378884 12:51138616-51138638 CTCAAAAGAAAAAAGAAATGTGG - Intronic
1096631042 12:52927029-52927051 AAGATAGGAAAAAAGCAATGTGG - Intronic
1096677783 12:53234752-53234774 ACCCAAGGGAAAGAGGAATGAGG - Intergenic
1096733571 12:53634352-53634374 ACCAAAGAAAAAAAGCATCTAGG - Intronic
1097004900 12:55909187-55909209 ACCAAAGAAAAAAAACTAGGAGG + Intronic
1097154611 12:57003717-57003739 AGAAAAGGAAAATACCAATGTGG + Exonic
1097407239 12:59204194-59204216 AAGAAAGGAAAAAAGAAATAAGG + Intergenic
1097639913 12:62168503-62168525 AGAAAAGGAAAAAAGATATGAGG + Intronic
1097817194 12:64088217-64088239 AACAAAAGAAAAAAACACTGAGG + Intronic
1098183917 12:67876884-67876906 AACAAAGAAAAAAAGGAAAGGGG + Intergenic
1098344785 12:69490604-69490626 ACCAAAAGAAAAAAACCATCTGG - Intronic
1098816637 12:75173483-75173505 ACAAAAGGAAAAAACAAAAGTGG + Intronic
1099014314 12:77325789-77325811 AGTAAAGGAAGAAAGAAATGAGG - Intergenic
1099808419 12:87549068-87549090 AATAAAGTTAAAAAGCAATGGGG + Intergenic
1099920596 12:88952605-88952627 ACCAAATGAAAACAGAAATGTGG + Intergenic
1099968106 12:89472491-89472513 ATAAAAGGAAAAAAGCAACTTGG - Intronic
1100099575 12:91087081-91087103 AAAAAAAAAAAAAAGCAATGGGG - Intergenic
1100782301 12:98041528-98041550 AGCAAAATAAAAAAGCAAAGTGG + Intergenic
1100870456 12:98905401-98905423 CTCCAAGGAAAAAAGGAATGAGG + Intronic
1101263576 12:103060700-103060722 ACCAACAAAAACAAGCAATGGGG + Intergenic
1101283330 12:103282686-103282708 TACAATGGAAAAAAGCGATGAGG + Intronic
1101439965 12:104696184-104696206 ACAAAAGGAAAAAAGAAAAAAGG - Intronic
1101443208 12:104718990-104719012 TCCAAAGGAGAAATGCATTGGGG - Intronic
1101676117 12:106918037-106918059 ACCAAAAGTAAAGAGCAAAGTGG - Intergenic
1101987548 12:109459462-109459484 ACCAAGTGAACAAAACAATGAGG + Intronic
1101994271 12:109513685-109513707 CCCAAAAGAAAAAAAAAATGTGG - Intronic
1102190739 12:110986058-110986080 GTCAAAGGAGAAAAGCAAAGGGG - Intergenic
1102202796 12:111069106-111069128 AAGAAAGAAAAAAAGGAATGTGG + Intronic
1103222870 12:119260511-119260533 TACTAAGGAAAAAAGAAATGGGG - Intergenic
1104220313 12:126776352-126776374 AGTAAGGGAATAAAGCAATGTGG + Intergenic
1104379168 12:128291843-128291865 AGAAAAGGAGAAAAGCACTGTGG - Intronic
1105073381 12:133252212-133252234 ACCACAGGAAAAATTTAATGGGG - Intergenic
1105372018 13:19810396-19810418 ACCAGAGGGAAAAAGCACTCAGG + Intergenic
1105471479 13:20698872-20698894 AGCACAGTGAAAAAGCAATGTGG + Intergenic
1105673206 13:22642950-22642972 ACCAAAGGAAATAAAGAAGGGGG + Intergenic
1106051602 13:26195338-26195360 ACCAAAGCTGAAAAGCAAAGAGG + Intronic
1106358756 13:29010545-29010567 CCCAAAGGAAAGAAGGAAAGGGG - Intronic
1106424213 13:29610556-29610578 AAAAAAAGAAAAAAGAAATGAGG - Intergenic
1106428087 13:29652627-29652649 ACCAAAGTACAAAAGGAAGGAGG - Intergenic
1106854498 13:33834587-33834609 TGCACAGTAAAAAAGCAATGTGG - Intronic
1107089922 13:36467967-36467989 ACTACAGGACAAAAGCACTGAGG - Intergenic
1107158747 13:37200177-37200199 ACCAACAAAAATAAGCAATGGGG - Intergenic
1107166852 13:37292574-37292596 AGTAAAGGGAAAAAGAAATGGGG - Intergenic
1108418212 13:50222233-50222255 ACCAAAGGCAAAAAGTGATGGGG + Intronic
1108450576 13:50558768-50558790 AACAAAGAAAAATTGCAATGGGG + Intronic
1108930438 13:55811320-55811342 ACCAAATTAAAAAAAAAATGGGG + Intergenic
1108972409 13:56393496-56393518 GCCAAAGGAAAAAGTCAATCTGG + Intergenic
1108985113 13:56576939-56576961 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1109438437 13:62337557-62337579 AGCAAAGGCAAAAGGCAAGGGGG - Intergenic
1109463063 13:62689408-62689430 AGCAAATGAAAAATGGAATGTGG - Intergenic
1109777706 13:67064010-67064032 AGCAAAGAAAAGAAGCAAAGAGG - Intronic
1109987557 13:70009970-70009992 ACCAAAGGAAAGGAGTAAGGAGG + Intronic
1110007933 13:70295421-70295443 AGCAAAGGAAGCAATCAATGGGG + Intergenic
1110128932 13:71982219-71982241 ACCAACAAAAACAAGCAATGGGG - Intergenic
1110324683 13:74200286-74200308 ACCAGAGGATGGAAGCAATGAGG + Intergenic
1111004965 13:82235385-82235407 AAGAAAGAAAAAAAGCAAGGAGG + Intergenic
1111065949 13:83091430-83091452 GCCAACAGAAAAAGGCAATGTGG - Intergenic
1111356070 13:87103817-87103839 ACTAAAGGAAAAAGGAAATAAGG - Intergenic
1111807151 13:93051908-93051930 ATGAAAGGAAAAAAGTTATGGGG - Intergenic
1112537019 13:100269146-100269168 AACAAATAAAAAAAGAAATGTGG - Intronic
1112557624 13:100483111-100483133 AAAAAAGGAAAAAAAGAATGGGG + Intronic
1112682581 13:101783946-101783968 ACAACAACAAAAAAGCAATGGGG - Intronic
1112804223 13:103145208-103145230 ACAAAAAGAACAAAGCAAGGAGG + Intergenic
1112807160 13:103175561-103175583 AGGAAAAGAAAAAAGCAAAGTGG - Intergenic
1113061552 13:106327945-106327967 AACAAAGCAAAAAAGAAATGAGG + Intergenic
1113932820 13:113977146-113977168 AGGAAAGGAATAAAGAAATGAGG + Intergenic
1114368453 14:22056886-22056908 GCCAAGGAAAACAAGCAATGGGG + Intergenic
1114459941 14:22879902-22879924 GCCCAAGAAAAAAAGAAATGAGG + Exonic
1114505229 14:23206552-23206574 AAGAAAGGAAAAAAGAAAAGGGG - Intronic
1114738248 14:25065354-25065376 ATCACAGGAAAAATGTAATGAGG - Intergenic
1115666071 14:35549227-35549249 ACCAAAGGAAATCAGCTATGAGG - Exonic
1116026258 14:39519104-39519126 ACCAACAAAAATAAGCAATGGGG + Intergenic
1116234628 14:42262476-42262498 GCAAAAGAAAAAAAGCAATTAGG - Intergenic
1116462210 14:45190718-45190740 ACCAAAAAAAAAAAAAAATGGGG - Intronic
1116671727 14:47850835-47850857 ACCAGACAAAACAAGCAATGGGG + Intergenic
1116987964 14:51241055-51241077 CCCAAAGGAAAAATGAGATGAGG - Intronic
1117190387 14:53284674-53284696 ACATAAGGACAAAAGTAATGAGG + Intergenic
1117386466 14:55218805-55218827 AACAGAAAAAAAAAGCAATGAGG - Intergenic
1118556052 14:67023747-67023769 AAAAAAGAAGAAAAGCAATGGGG + Intronic
1118736122 14:68703046-68703068 GCCCAAGGAAAAAGGAAATGGGG - Intronic
1119091099 14:71782028-71782050 AACAAAGAAAATAAGCAACGGGG + Intergenic
1119575595 14:75718684-75718706 ATCAAAGAAAGAAAGAAATGAGG + Intronic
1119583724 14:75812117-75812139 ACTAAAGGAAAAACGCACTGAGG + Intronic
1119664485 14:76474923-76474945 ACCAAAAAAAAAAAGAAAGGAGG + Intronic
1120346273 14:83294231-83294253 AGAAAAGGAAAAAAAGAATGAGG - Intergenic
1121031721 14:90664060-90664082 ACCCATGGTAAAAAGGAATGTGG + Intronic
1121835356 14:97087396-97087418 ACCAAAGGAAAAAGCCAAGGGGG - Intergenic
1121891195 14:97592765-97592787 ACCAAAAGAAAACAACAATGGGG + Intergenic
1121910271 14:97783960-97783982 ACCAAAACAAAAAAACATTGCGG + Intergenic
1122244731 14:100394477-100394499 ACCAAATGAAGAAAGAAGTGAGG - Intronic
1122391717 14:101393329-101393351 TCCAAAAGAAGAAAGAAATGGGG - Intergenic
1122557522 14:102589747-102589769 ATGAAAGGAAAAAGGCAAGGAGG + Intergenic
1123111816 14:105874242-105874264 ACCAAAAGCAAATAGCAATATGG - Intergenic
1123683600 15:22781917-22781939 ACCAAAGAAAATATGCAAGGCGG + Intronic
1124069087 15:26374829-26374851 ACCAAAGGAGGAAAACACTGAGG - Intergenic
1124154589 15:27214690-27214712 ACCAAAAAAAAAAAAAAATGTGG - Intronic
1124371936 15:29108993-29109015 AACAAAGGAAAAAAGAATTCAGG - Intronic
1124660147 15:31541354-31541376 AACAAAAGTAAAAATCAATGAGG - Intronic
1124683921 15:31762321-31762343 GACAGAGAAAAAAAGCAATGAGG - Intronic
1125004741 15:34804677-34804699 ACAAAAGGAAAAAGCCAATTCGG + Intergenic
1125586937 15:40827513-40827535 GGCAAAAGAAAAAAGAAATGTGG + Intronic
1126034569 15:44535083-44535105 ACCAAAAAAAAAAAAAAATGTGG - Intergenic
1126097578 15:45100344-45100366 ATGAATGGAAAAAAGCAATCTGG + Intronic
1126107728 15:45157836-45157858 AAAAAAGGAAAAAAGAAAGGTGG + Intronic
1126471729 15:49019751-49019773 TCGAGGGGAAAAAAGCAATGTGG - Intronic
1126755036 15:51917585-51917607 ACCAAAGGGAATATGCATTGAGG - Intronic
1126870576 15:52982701-52982723 AAGGAAGGAAAAAAGCAATGTGG - Intergenic
1127713669 15:61626301-61626323 AGAAAAGAAAAAAAGCAAAGTGG + Intergenic
1128410263 15:67389871-67389893 ACCAAAAAAAAAAAAAAATGGGG + Intronic
1130334630 15:82948563-82948585 AACAAAAGAAAAAAGAAAAGGGG + Intronic
1131692680 15:94844596-94844618 ACAAAAAGAAAAATGAAATGTGG - Intergenic
1131707064 15:95008461-95008483 ACAAAAACAAAAAAACAATGGGG - Intergenic
1134056722 16:11174717-11174739 AAGAAAGGAAAAAAGAAATGAGG - Intronic
1134326126 16:13209598-13209620 ACTAAAGCAAAAATGTAATGTGG + Intronic
1134852698 16:17494317-17494339 ACTAAAGGATAAATGCAGTGAGG - Intergenic
1135471738 16:22737244-22737266 TCCCAAGGAAAAAAGAAAAGAGG + Intergenic
1137428903 16:48402429-48402451 AAAAAAAGAAGAAAGCAATGAGG - Intronic
1138365570 16:56473734-56473756 CCCAAAGGAAAAATACACTGAGG - Intronic
1138852161 16:60642103-60642125 ACAAAATGGAAAAAGCAAGGGGG + Intergenic
1139038567 16:62977145-62977167 ACCAAAGAAAAAAATGAATGAGG + Intergenic
1139141111 16:64263794-64263816 ACCAAAGGAAAAAAAAAAGGTGG + Intergenic
1139369179 16:66455497-66455519 GCCAAAGCAAAACAGCAAAGTGG + Intronic
1139640486 16:68288072-68288094 ACCAAAGGAAACCAGCCCTGAGG - Intronic
1139784830 16:69384474-69384496 GGCAGAGGAAAACAGCAATGGGG - Intronic
1140572568 16:76125808-76125830 AAAAAAAAAAAAAAGCAATGGGG + Intergenic
1141111287 16:81272963-81272985 ACAAAAAGAAAAAAAAAATGGGG - Intronic
1141860155 16:86710908-86710930 TCCAAAGGAACAAAGGGATGGGG + Intergenic
1142565135 17:835406-835428 AACAAAGAAAAAAAACAAAGAGG + Intronic
1144014355 17:11179844-11179866 AGTAAAGGAAAAAAAAAATGTGG + Intergenic
1145400068 17:22524553-22524575 ACGAAAGGATAAGAGAAATGGGG + Exonic
1145885522 17:28380036-28380058 AGAAAAGAAAAAAATCAATGAGG - Intronic
1145966772 17:28924649-28924671 ACCAATAGTAAAAATCAATGGGG + Intronic
1146081555 17:29784896-29784918 AGGAGAGGAAAAAAGCAATGTGG - Intronic
1146109124 17:30071170-30071192 TGCAAAGGAAACAATCAATGGGG + Intronic
1146152903 17:30491667-30491689 AAGAAAGGAAAAGACCAATGTGG + Intronic
1146379506 17:32318470-32318492 AACAAACAAAAAAACCAATGAGG + Intronic
1146898569 17:36564769-36564791 AACAAATTAAAAAAGCTATGGGG - Intronic
1146942353 17:36852086-36852108 AGAAAAGGAAGAAAGAAATGTGG + Intergenic
1147122104 17:38341654-38341676 ACCACAGGAAAGAAGGATTGAGG - Intronic
1147729466 17:42589104-42589126 ACCAAAAAAAAAAAAAAATGGGG + Intronic
1148076519 17:44939493-44939515 AGCCAAGAAAAAGAGCAATGAGG - Intronic
1148652120 17:49257791-49257813 ACCAAAGGAAAAAAGTGAAGTGG - Intergenic
1148955485 17:51350480-51350502 ACCACAGGACAAAAGCAATATGG - Intergenic
1149217289 17:54372188-54372210 AACAAACAAAAAAAACAATGTGG + Intergenic
1149231838 17:54544200-54544222 ACCAGAGTAAAAAAGCAACATGG + Intergenic
1150217977 17:63480812-63480834 GCCCAAGGAAACAAGCACTGTGG + Intergenic
1150480909 17:65509479-65509501 AATAAAGGAGAAAAGCCATGTGG + Intergenic
1150589961 17:66553605-66553627 ATCCAAGAAAAACAGCAATGAGG - Intronic
1150963240 17:69937824-69937846 ACAACAACAAAAAAGCAATGTGG + Intergenic
1151320827 17:73351408-73351430 ACAAAAGAAAAAAAGAAAAGGGG - Intronic
1151948704 17:77334517-77334539 CCAAAAGGAAAGGAGCAATGTGG - Intronic
1153128450 18:1825605-1825627 AGCAAGGAAAAAAAGCAATCTGG + Intergenic
1153213249 18:2791287-2791309 ACCAAAGAAAAAAACCACTGAGG + Intronic
1153237902 18:3005974-3005996 AGCATAGGAACAAGGCAATGTGG + Intronic
1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG + Intronic
1153577684 18:6539226-6539248 ACCAAAAGAAAGGAGCAAGGAGG + Intronic
1153847527 18:9063180-9063202 AACAAACAAATAAAGCAATGGGG - Intergenic
1153978984 18:10293510-10293532 AACAAAGGCAAAAAGCAAAAAGG + Intergenic
1154039024 18:10835272-10835294 ACCAAAAAAAAAAAAAAATGAGG - Intronic
1154181439 18:12142896-12142918 AAAAAAGGAAAAAAGAAAAGTGG - Intergenic
1154182465 18:12148688-12148710 AAAAAAGGAAAAAAGAAAAGTGG + Intergenic
1155497300 18:26455332-26455354 GACAAAGGAAAAAAGAAATATGG + Exonic
1155719230 18:28990216-28990238 AACAAAGGAAAAAACCCTTGTGG + Intergenic
1155828229 18:30477065-30477087 AGAAAAGGAAAAATGCAAAGAGG + Intergenic
1156965233 18:43083610-43083632 ACAAAAACAAACAAGCAATGGGG + Intronic
1157087675 18:44598204-44598226 ACCAAAGGAAAAAAAAAAGGAGG + Intergenic
1159129402 18:64263337-64263359 AACAAAGTAAAAAGCCAATGGGG + Intergenic
1159728985 18:72001488-72001510 AAAAAAAAAAAAAAGCAATGGGG - Intergenic
1160401688 18:78614920-78614942 ACCAACAAAAAAGAGCAATGGGG + Intergenic
1160448445 18:78945275-78945297 ATCACAGCAAAAAATCAATGTGG - Intergenic
1161129960 19:2581997-2582019 ACCAAAGTGAAAAAGCAAAATGG + Intronic
1162158109 19:8693716-8693738 ACCACAGCAAACAAGAAATGGGG - Intergenic
1162438435 19:10677975-10677997 ACCAAAGGTAAACAGCAACAAGG - Intronic
1163165932 19:15498198-15498220 ACCACAGTAAAAAAGTAATGTGG - Intronic
1163270709 19:16251797-16251819 AGCAAAGGAAGAGAGCACTGAGG - Intergenic
1163286216 19:16349789-16349811 AGCAAAGGAAGACAGCCATGCGG + Intergenic
1163422643 19:17222902-17222924 AAAAAAGAAAAAAAGAAATGGGG + Intergenic
1164613307 19:29648247-29648269 AAAAAAGGAAAAAAGAAAAGAGG + Intergenic
1164631053 19:29761711-29761733 AAGAAAGGAAAAAAGAAAAGGGG + Intergenic
1164935772 19:32210060-32210082 ACCACAGAAAAAAAGCCTTGTGG + Intergenic
1166602450 19:44109754-44109776 ACAAAAGGAGAAAAACAATGTGG + Exonic
1166632801 19:44422137-44422159 ACCTGACAAAAAAAGCAATGGGG - Intronic
1167028630 19:46941231-46941253 TCCACAGGCAAAAAGGAATGGGG - Intronic
1167791226 19:51683529-51683551 ACCAAAGAAAAAAATAAATGAGG + Intergenic
1167977206 19:53238501-53238523 ACCAAAGGAAAATAATAAAGAGG - Exonic
925069260 2:953559-953581 ACCAAAGCATAGAAGGAATGGGG - Intronic
925490221 2:4383207-4383229 GCCAAAGGAAAAAGTCAATCCGG + Intergenic
925810900 2:7699448-7699470 AAGAAAAGAAAAAAGAAATGTGG - Intergenic
926039233 2:9659553-9659575 ACAAAAAGAAAAATCCAATGGGG + Intergenic
926529444 2:14024735-14024757 AGCAAAGCAAAAAAGCAGTAAGG - Intergenic
926546920 2:14253272-14253294 ACCAAAGGAAAAAATCATGAGGG - Intergenic
927721918 2:25388532-25388554 AGAAAAGGAAAAAAGGAAGGGGG + Intronic
928019064 2:27686828-27686850 ACCACAGGAAAAAAGGCCTGGGG - Intronic
928127773 2:28628181-28628203 CCCAAAGGAAAAAGGAAGTGTGG + Intronic
928413522 2:31072394-31072416 AAGAGAGGAAGAAAGCAATGAGG - Intronic
928479371 2:31666507-31666529 ATCAAAGGACATAAGCTATGGGG + Intergenic
928581055 2:32707961-32707983 AACAAAAAAAAAAAGAAATGAGG + Intronic
928602825 2:32918004-32918026 ACCAAATGAAGAAAAAAATGAGG + Intergenic
929879707 2:45825076-45825098 CCCGGAGGAAAAAAGTAATGTGG - Intronic
930113565 2:47699481-47699503 ATCAAAGGAAAAAAGTATGGGGG + Intronic
930433684 2:51313970-51313992 ACCTCAGAAAACAAGCAATGGGG - Intergenic
930447046 2:51487100-51487122 CCCAAAGGAAAAAAGCAGAAAGG - Intergenic
930613216 2:53566013-53566035 ACCAAAGGAAAATTGTAAAGTGG - Intronic
930657640 2:54022197-54022219 AACAAAAGAAAAAAGGAAGGAGG - Intronic
930917811 2:56715272-56715294 AACCAAGGAGGAAAGCAATGGGG - Intergenic
931420991 2:62127602-62127624 ACCTGACAAAAAAAGCAATGGGG + Intronic
931523313 2:63124402-63124424 ACCACATGTAGAAAGCAATGAGG - Intronic
931565587 2:63612892-63612914 AGAAAAGGAAAAAACCTATGGGG - Intronic
931598551 2:63977788-63977810 ACCAAAGTTAAAAAGAACTGAGG + Intronic
931846661 2:66211099-66211121 ACCTGAGAAAACAAGCAATGGGG + Intergenic
932174572 2:69587911-69587933 AAAAAAAGAAAAAAGAAATGAGG - Intronic
933282120 2:80343935-80343957 ACCAAAGGGATAAAGGAATGGGG - Intronic
934939257 2:98488673-98488695 ACCAGAGGAAAAAACCAGAGGGG + Intronic
935387641 2:102517441-102517463 ACCAAAAGAGAAAAAGAATGAGG + Intronic
936172386 2:110187582-110187604 ACCAAAGGTAAAAAGAAGAGTGG + Intronic
936249554 2:110857386-110857408 ATCAAAGGCAAGAAGCATTGGGG + Intronic
936592216 2:113815040-113815062 ACCAAGAGAAAAATGAAATGGGG + Intergenic
936676932 2:114726349-114726371 CCCCAAGGTAAATAGCAATGAGG + Intronic
937079027 2:119127118-119127140 ACAAAAGAAAAAAAGAAAGGAGG - Intergenic
937165936 2:119817323-119817345 AAAAAAAAAAAAAAGCAATGGGG - Intronic
937384280 2:121413281-121413303 AACAAACAAAAAAAGCAAAGGGG + Intronic
937776604 2:125784745-125784767 TCCAAAGAATAAAAGTAATGCGG - Intergenic
938165204 2:129020017-129020039 AAAAAAGGAAAAAAGAAATGAGG - Intergenic
939344777 2:140950054-140950076 ACCAAAGGGAAAAAGCAAAGAGG + Intronic
940177621 2:150896202-150896224 ACCAAAGGAAAGAATGAATAAGG - Intergenic
940337128 2:152541136-152541158 AGAAAAGAAAAAAAGAAATGAGG - Intronic
940392933 2:153153655-153153677 AAAAAAAAAAAAAAGCAATGGGG - Intergenic
940575124 2:155493744-155493766 AAGAAAGGAAGAAAGCAAAGAGG - Intergenic
940704693 2:157089177-157089199 ATCAAAGGGAAAAATAAATGTGG + Intergenic
940799530 2:158118091-158118113 AATAAAAGAAAAAGGCAATGTGG - Intronic
941306642 2:163877386-163877408 ACCAGGGGAAAAGAGCAAAGGGG + Intergenic
941762756 2:169262971-169262993 ACCTGAGAAAAAAAGCAATGGGG + Intronic
942226305 2:173819503-173819525 AAAAAAGGAAAAAAGTGATGGGG + Intergenic
943018376 2:182542976-182542998 GCCAAAGGAAAAACGAGATGTGG - Intergenic
943136067 2:183914409-183914431 ACCTGAGAAAAACAGCAATGGGG - Intergenic
943215784 2:185031699-185031721 ACCAAAGGAAACAAGTAACAGGG - Intergenic
943839952 2:192567021-192567043 ACCAAAAAAAAAAAAAAATGTGG + Intergenic
943871108 2:193000991-193001013 ACAATAGAAAAAAAGTAATGAGG - Intergenic
943876929 2:193078956-193078978 CCCAAAGGGAGAAAGCAATATGG + Intergenic
944045165 2:195403019-195403041 ACAAAAAGAAAAAAAGAATGGGG - Intergenic
944055543 2:195518536-195518558 AAGAAAGGGAAAAAGAAATGTGG - Intergenic
944506493 2:200417743-200417765 TCCAAAGGAAAAAAGCAGGGAGG + Intronic
944891491 2:204121956-204121978 AAAAAAGGAAAAAATCAATGGGG + Intergenic
945372078 2:209031356-209031378 ACAGAAGGAATAAAACAATGAGG + Intergenic
945461300 2:210112221-210112243 ACCTAACAAAAACAGCAATGGGG + Intronic
945563173 2:211363450-211363472 AAAAAAACAAAAAAGCAATGGGG + Intergenic
945700858 2:213169663-213169685 TGAAAAGGAATAAAGCAATGGGG + Intergenic
945830898 2:214783745-214783767 ACCTAACAAAACAAGCAATGGGG + Intronic
945839721 2:214873098-214873120 ACCAAACAAACAAAACAATGGGG - Intergenic
945925668 2:215801076-215801098 AGCAAAGGAAGAAAACAATAAGG + Intergenic
946761552 2:222998883-222998905 CGGAAAGGAAAAAAGCAATGAGG + Intergenic
947292048 2:228586322-228586344 GTCAAAGAAAAATAGCAATGTGG - Intergenic
947351458 2:229250465-229250487 ACCACAGGAAAAAAGCACAAAGG + Intronic
948298219 2:236880580-236880602 AACAAATAAAAAAATCAATGGGG - Intergenic
948704659 2:239781379-239781401 TCCCAAGGAGAAAAGCAAAGGGG + Intronic
948951165 2:241252776-241252798 ACCAAAGGGAAAAGGAAAAGTGG + Intronic
1168749298 20:270972-270994 ACCACAGGAAGAAAGAAAGGAGG + Exonic
1168889689 20:1286890-1286912 ACCAAAGGACTAAAGGGATGTGG - Intronic
1169509983 20:6253073-6253095 ACCAAAGGTAAGAATAAATGAGG - Intergenic
1169546703 20:6657763-6657785 AAGAAAGGAAAAAAGGAAGGAGG + Intergenic
1169560096 20:6790560-6790582 ACCAGGGGAAAAAAGCACTTGGG + Intergenic
1169813649 20:9633998-9634020 ATCAAAAGAAAAAAGGCATGTGG - Intronic
1169902203 20:10565038-10565060 ACAAAAGGAAAAAAAAAATTAGG - Intronic
1170021734 20:11844249-11844271 AACAAAGGAAAAAAGAAAGAAGG + Intergenic
1170389951 20:15861455-15861477 AACACAAGAAAAAAGAAATGTGG + Intronic
1170467403 20:16635394-16635416 ACACAAGGAAAAAATCCATGTGG + Intergenic
1170542523 20:17403681-17403703 ATAAAAGGACAAATGCAATGCGG + Intronic
1170865971 20:20158265-20158287 ATCAAATGAAAAAAAAAATGTGG + Intronic
1171036700 20:21718251-21718273 ACCAAAGGAAAGGAGGATTGAGG + Intronic
1171158898 20:22903754-22903776 ATCAAAGGAAAAAACAGATGAGG - Intergenic
1171818709 20:29812691-29812713 AACAATGGAGAAAAGAAATGTGG - Intergenic
1172104526 20:32508748-32508770 CCCAAAGGAAGAAAGGACTGTGG - Intronic
1172125553 20:32623349-32623371 AAAAAAAGAAAAAAGCAGTGTGG + Intergenic
1172399182 20:34634627-34634649 TCAAAATGAAGAAAGCAATGAGG + Exonic
1172814719 20:37677230-37677252 AGGAAAGGAAAAAAGGAAAGAGG - Intergenic
1173025186 20:39301081-39301103 ATCAAAGGAAAGTAGAAATGTGG - Intergenic
1173109477 20:40173232-40173254 ACAAAAGGAAAAAAGTACTTTGG - Intergenic
1173500211 20:43547898-43547920 AAAAAAGGAAGACAGCAATGGGG - Intronic
1173619460 20:44425640-44425662 AAAAAAGGAAAAAAGAAAAGAGG - Intronic
1174645287 20:52080206-52080228 ACAAAAGAAAAAAAGCAAGCAGG + Intronic
1174923232 20:54727648-54727670 TTCAAAGGAGAAAAACAATGAGG - Intergenic
1175638761 20:60608696-60608718 AACAAGTTAAAAAAGCAATGAGG + Intergenic
1176909001 21:14540018-14540040 ACCTGAGAAAACAAGCAATGGGG + Intronic
1177126385 21:17198407-17198429 AACAAAGAAAAAAAGAAATGTGG - Intergenic
1177147276 21:17420351-17420373 ACCAAGGGTCAAAAGCAGTGGGG - Intergenic
1177648693 21:23933486-23933508 AACAAAGGAAAGAAGGAATGAGG - Intergenic
1177807771 21:25890726-25890748 AAAAAAAAAAAAAAGCAATGGGG + Intronic
1178033950 21:28559851-28559873 CCCAAAGAAAACAAGCAATGGGG + Intergenic
1178079420 21:29047767-29047789 ACTCAAAAAAAAAAGCAATGGGG - Intronic
1178533407 21:33393441-33393463 AAAAAAAGAAAAAAGGAATGTGG + Intergenic
1178637498 21:34317409-34317431 AAGAAAGGAAAGAAGGAATGGGG - Intergenic
1178956225 21:37024530-37024552 AAAAAAAAAAAAAAGCAATGGGG - Intergenic
1179319449 21:40275840-40275862 ACCAAAGGAAGAGAAGAATGTGG + Intronic
1180238559 21:46481748-46481770 ACAATAGGAAAAAATCAGTGGGG + Intronic
1180322157 22:11332065-11332087 AACAATGGAGAAAAGAAATGTGG - Intergenic
1180332763 22:11547637-11547659 AACAATGGAGAAAAGAAATGTGG + Intergenic
1180597039 22:16983985-16984007 AGCAAAGGAAAAAATTAATAAGG + Intronic
1180681383 22:17629199-17629221 ACCAAAAGAAAAAAAAAAGGGGG + Intronic
1181180148 22:21061824-21061846 ACCAGTGGATAAATGCAATGTGG + Intronic
1181279052 22:21705527-21705549 AACAAAGGCAAAAGGCTATGAGG + Intronic
1181990704 22:26834729-26834751 ACCAAGGGAAACAAGCTGTGGGG - Intergenic
1181997573 22:26894811-26894833 AGAAAAGGGAAAAATCAATGTGG + Intergenic
1182366993 22:29785946-29785968 AACAAAAGAAAAATGCAAGGGGG - Intergenic
1182495988 22:30707878-30707900 AAAAAAAGAAAAAAGAAATGGGG - Intronic
1182930434 22:34168387-34168409 TCCAAAGGAAGAAATCAGTGGGG - Intergenic
1183237257 22:36628775-36628797 TTCAAAAGAAAAAAGCAGTGGGG - Intronic
1184044612 22:41965070-41965092 AAAAAAAAAAAAAAGCAATGGGG - Intergenic
1184820333 22:46905253-46905275 ACAAAAGATAAAAAGGAATGAGG + Intronic
1185210193 22:49566408-49566430 ACCAAAGGAAAAAAGACACAGGG - Intronic
1185244855 22:49768136-49768158 AGCAAATGAAAAAAGAATTGAGG - Intergenic
949126712 3:453660-453682 GTCAAAGTAAGAAAGCAATGTGG - Intergenic
949147136 3:715491-715513 ACCAACAGAAAACAACAATGGGG - Intergenic
949927205 3:9051009-9051031 AAAAAAAAAAAAAAGCAATGAGG - Intronic
950236364 3:11324667-11324689 CCCTAAGGACAAAGGCAATGGGG - Intronic
951233458 3:20206949-20206971 ACCAACAAAAACAAGCAATGAGG - Intergenic
951296863 3:20947875-20947897 GCCAAAAAAAAAAAGCAATGGGG - Intergenic
951453446 3:22864872-22864894 ACGAAAAAAAAAAAGCAATTTGG + Intergenic
952010010 3:28889874-28889896 ACCTGACAAAAAAAGCAATGGGG - Intergenic
952574001 3:34752511-34752533 ACCAACAAAAACAAGCAATGGGG + Intergenic
952598283 3:35045382-35045404 CCCAAAGTAAAAAAGTAAAGTGG - Intergenic
952937930 3:38415171-38415193 AACAAAGCAAGATAGCAATGGGG + Intronic
953713080 3:45291577-45291599 ACCAAAGGACAGAAGGAAGGAGG + Intergenic
954064827 3:48097539-48097561 TCCAAAAGAAAAAAGAAATGGGG + Intergenic
954522298 3:51239501-51239523 ACCAAATGCACAAAGAAATGAGG - Intronic
954535738 3:51358148-51358170 ACCAAAGGAAAATAGGAGAGAGG + Intronic
955439036 3:58935649-58935671 ACCTGAGAAAAACAGCAATGGGG + Intronic
956380433 3:68659199-68659221 ACGAAAGGACAAGAGAAATGGGG - Intergenic
956739983 3:72268180-72268202 ACCAAAGCAAGACAGCAATGGGG + Intergenic
956929052 3:74021799-74021821 AAAAAAGGAAAAAAGCATTAAGG - Intergenic
957087786 3:75698737-75698759 AACAATGGAGAAAAGAAATGTGG + Intergenic
957401306 3:79718008-79718030 AACAAAGGAAAAAATAAATTAGG + Intronic
957447506 3:80333282-80333304 AGCAAAGGAAATAATCAATAAGG - Intergenic
957456978 3:80464253-80464275 GCCATAGAAAAAGAGCAATGGGG - Intergenic
957478748 3:80762177-80762199 ATAAAAGAAATAAAGCAATGCGG + Intergenic
957830446 3:85510011-85510033 AACAAAAAAATAAAGCAATGTGG + Intronic
957975453 3:87437689-87437711 ACCAAAAGAAAAAAGTAGTTAGG + Intergenic
958046511 3:88290586-88290608 AAATAAAGAAAAAAGCAATGTGG + Intergenic
958048891 3:88319429-88319451 ACCAGAAGCAAAAAGGAATGGGG - Intergenic
958479441 3:94628060-94628082 AAGGAAGGAAAAAAGGAATGGGG - Intergenic
958677550 3:97286197-97286219 AGCAAAGGAAATAATCAATAGGG - Intronic
958785890 3:98595554-98595576 ACCAGAGGAAGAAAGGAGTGAGG - Intergenic
958911981 3:100004451-100004473 ACAGAAGGAAAAATCCAATGAGG + Intronic
959829597 3:110844569-110844591 ACCTAACAAAAAAAGCAATGGGG + Intergenic
959936047 3:112030124-112030146 ACCAAAGTAAAAAAAAATTGTGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960180282 3:114567753-114567775 GACAAAGGAAACAACCAATGAGG + Intronic
961618951 3:128207997-128208019 ACCAAAGGAAAAAAAGAAACAGG - Intronic
961912899 3:130339086-130339108 ACAAAAAAAAAAAAGCAATGAGG - Intergenic
963230118 3:142901122-142901144 ACCAAGGGAAAAAGGAAAGGGGG - Intergenic
963242373 3:143019989-143020011 AGAAAAGAAAAAAAGCAATTTGG + Exonic
963556432 3:146794641-146794663 ACCAAAGAAAAAAATCACTGTGG + Intergenic
963575725 3:147059089-147059111 AACAAAGCAAAGAAGGAATGAGG - Intergenic
963694251 3:148544837-148544859 ACCTGACAAAAAAAGCAATGAGG + Intergenic
963892080 3:150647341-150647363 ACAAAAGAAAGAAAGAAATGTGG - Intergenic
964123984 3:153216941-153216963 ACCAAAGGAAAACAGCACTAAGG + Intergenic
964241071 3:154595349-154595371 ACCTGAGAAAACAAGCAATGGGG - Intergenic
964268076 3:154922396-154922418 GCCAAAGGAAGAGAGCAAGGAGG + Intergenic
964323272 3:155519835-155519857 GCCAAAGGAAAAAAAAATTGGGG - Intronic
964699688 3:159552024-159552046 AAAAAAAAAAAAAAGCAATGTGG - Intronic
965162122 3:165147370-165147392 ACCAAAGGAATTAAGAAATCTGG - Intergenic
965716130 3:171605113-171605135 AACAAAGGCAAAAAGCATTGTGG - Intronic
965887057 3:173458818-173458840 ACCATAAGAAAAAAGCCAAGGGG - Intronic
966564983 3:181369116-181369138 AAAAGAGGAAAAAAGCAAAGCGG - Intergenic
966889860 3:184399120-184399142 AAAAAAAAAAAAAAGCAATGGGG - Intronic
966992711 3:185250304-185250326 ACCAAAGGAAAAGAGAGCTGAGG + Intronic
968795724 4:2702914-2702936 ACAAATGGAAAAACGCAATCAGG - Intronic
969196041 4:5564754-5564776 AGCCAAGGAAAAAGGCATTGGGG + Intronic
970302517 4:14696415-14696437 ACCAAAGGAGAAAGGGAAGGAGG + Intergenic
970353601 4:15230622-15230644 ACCAAAGAAAAAAAGAAATTGGG + Intergenic
970475823 4:16421869-16421891 ACCTGAGAAAACAAGCAATGGGG + Intergenic
970738403 4:19202007-19202029 TCCAAAGGAAAATAGAAATAAGG - Intergenic
970812375 4:20109565-20109587 AACAAACAAAAAAACCAATGGGG - Intergenic
970852971 4:20623829-20623851 AAGAAAGAAAGAAAGCAATGAGG + Intergenic
971192426 4:24440332-24440354 ATTAAAGGAAAAAACCGATGAGG - Intergenic
971499292 4:27300975-27300997 AAGAAAAGAAAAAAGAAATGAGG - Intergenic
971739814 4:30504843-30504865 GCCAACGGAAACAAGCAATGGGG - Intergenic
971817571 4:31508169-31508191 ACTTAAGAAAAAAATCAATGAGG - Intergenic
971828601 4:31660676-31660698 ATCAAAGGAAAAAGGAGATGTGG - Intergenic
971912945 4:32819780-32819802 ATAAAAGAAAAGAAGCAATGTGG - Intergenic
972083938 4:35189709-35189731 AGCATAGGAAAAAAGAAATAAGG + Intergenic
972778193 4:42262922-42262944 AACAAAGGAAAAAAGTCATGGGG + Intergenic
972787937 4:42345071-42345093 ATCAAATGAGAAAAGTAATGTGG - Intergenic
972953602 4:44360874-44360896 TCAAATGGAAAAAAGCCATGAGG - Intronic
973056109 4:45660428-45660450 AACAAAGAAAAAAATCAGTGTGG - Intergenic
973201672 4:47510403-47510425 AATAAAGGAGAAAGGCAATGTGG + Intronic
973722505 4:53739512-53739534 ACCTGAGAAAACAAGCAATGGGG + Intronic
973733623 4:53848232-53848254 ACCCTTGGAAAAAAGCAATGAGG - Intronic
974455437 4:62124329-62124351 AACACAGGAAAAATGCAAGGGGG - Intergenic
974805331 4:66872296-66872318 AACAGAGTGAAAAAGCAATGTGG - Intergenic
975393397 4:73847086-73847108 AGGAAAGGAAAAAATCAATATGG + Intronic
976007914 4:80452803-80452825 ACTAATGGAAAACATCAATGCGG - Intronic
976110554 4:81668649-81668671 AGAAAAAGAAAAAAGAAATGTGG + Intronic
976452992 4:85213460-85213482 AAAAAAAAAAAAAAGCAATGAGG - Intergenic
976459256 4:85289026-85289048 ACTTAACTAAAAAAGCAATGGGG + Intergenic
976870405 4:89786260-89786282 ACCATAGGCAATAAACAATGGGG - Intronic
977398697 4:96503770-96503792 AGCAAAGGCCAAAATCAATGAGG + Intergenic
977411768 4:96675104-96675126 ACCAAAAAAAAAAAAAAATGGGG - Intergenic
977557542 4:98500389-98500411 AGCCAAGGAGAAAAGCAATATGG + Intronic
977696034 4:99967489-99967511 CACAAAGTAAAAAACCAATGTGG - Intergenic
977828689 4:101564297-101564319 AGTGAAGGTAAAAAGCAATGTGG - Intronic
978251983 4:106641735-106641757 AGCAAAGGAAAAAAGAGAGGTGG - Intergenic
978872699 4:113599499-113599521 ACAAAAGGAAATAAGCTATAAGG + Intronic
979113336 4:116788094-116788116 ACAATAGGAACAAAGCAATGGGG + Intergenic
979309420 4:119184713-119184735 AACAAAGCAAAAAAGTTATGTGG + Intronic
979469583 4:121078830-121078852 CCTAAAGGAATAAAGCAATGAGG + Intergenic
980201036 4:129656377-129656399 ACAAAAAAAAAAAAGCAGTGGGG + Intergenic
980455429 4:133034638-133034660 ACTAAAAGACAAAACCAATGTGG + Intergenic
980706088 4:136497744-136497766 TCCAAAGGATGAATGCAATGTGG + Intergenic
980775655 4:137432594-137432616 CCCAGAGGGAAAGAGCAATGTGG + Intergenic
980863433 4:138526380-138526402 ACCAACAAAAAAAAGGAATGGGG + Intergenic
980964817 4:139511283-139511305 GCCATAGGAAAAAAGCACTATGG + Exonic
981111805 4:140943207-140943229 GCCAAAGGAAAATAAAAATGAGG + Intronic
981278411 4:142928869-142928891 ACCAAAGGACAAAGGCAAACTGG + Intergenic
981705676 4:147656798-147656820 AAGAAAGAAAAAAAGAAATGAGG + Intronic
981964644 4:150584479-150584501 ACCAAAAGCAAAACGAAATGGGG - Exonic
982755450 4:159213162-159213184 CCCAAAGGAAACAAGCAACTTGG - Intronic
982836846 4:160129815-160129837 AGCAAAGGAAAAAGGCATAGTGG - Intergenic
982841751 4:160196436-160196458 AACAAAAGAAAATACCAATGTGG - Intergenic
982999250 4:162391079-162391101 AGGAAAGGAAAAAAGGAAGGAGG + Intergenic
983059697 4:163143783-163143805 GCCAAAGGAGAAAGGAAATGAGG + Intronic
983286061 4:165740817-165740839 ACCAAAGGAAAAAAAAAGTAAGG + Intergenic
983667645 4:170199736-170199758 AAAAAAAAAAAAAAGCAATGGGG + Intergenic
983899441 4:173118082-173118104 ACCAACAGAAACAAGCAATGGGG + Intergenic
984188933 4:176581553-176581575 TACAAAGCAAAAAGGCAATGAGG + Intergenic
984401410 4:179270087-179270109 ATAAAAGGAAACATGCAATGAGG - Intergenic
984426390 4:179592297-179592319 ACTAAAGGAAGAAAGAAATTTGG - Intergenic
985006216 4:185537418-185537440 TCCAAAGAAAAAAACAAATGAGG - Intergenic
985339315 4:188931917-188931939 ACCTATGGAAAAAAAAAATGAGG - Intergenic
985375398 4:189332208-189332230 TCAAAAGAAAATAAGCAATGAGG + Intergenic
985443198 4:190000082-190000104 AACAATGGAGAAAAGAAATGTGG - Intergenic
985985893 5:3515946-3515968 CCCAGAGGAGAAGAGCAATGAGG + Intergenic
986128689 5:4907470-4907492 CCCCAGGGAAAAAAGCACTGAGG + Intergenic
986325532 5:6670465-6670487 ACCAAAGCTAAAATCCAATGAGG + Intergenic
986467429 5:8039783-8039805 AACAAAGAAAAAAAGAGATGAGG - Intergenic
986487221 5:8249840-8249862 ACCAAGGAAAGAAAGCAATGAGG - Intergenic
986516787 5:8572970-8572992 ACCAAAGGAAAAAGAACATGAGG - Intergenic
987112867 5:14703152-14703174 ACAAAAGGAAAAAATAAATCAGG - Intergenic
987553159 5:19410052-19410074 AAAAAAAAAAAAAAGCAATGGGG - Intergenic
988352671 5:30131629-30131651 ACCTGACAAAAAAAGCAATGGGG - Intergenic
988465206 5:31483818-31483840 ACCCAAGGAAGACTGCAATGAGG + Intronic
988855066 5:35220265-35220287 ACCCGAGGTAAGAAGCAATGAGG - Intronic
988984609 5:36604888-36604910 ACCAAAAAAAAAAAGCGGTGGGG + Intergenic
989049260 5:37302700-37302722 ACCAAGGGAAGAATGGAATGTGG + Intronic
989225777 5:39026367-39026389 ACAAAAGGAAAAAATAAATGTGG + Intronic
989858988 5:46341629-46341651 ACCTGAGAAAACAAGCAATGGGG - Intergenic
990020272 5:51117993-51118015 ACCAACAAAAAACAGCAATGGGG - Intergenic
990057877 5:51607682-51607704 ACAAAAGGAAAAAAAAAAAGAGG - Intergenic
990138628 5:52677916-52677938 ACCTGACAAAAAAAGCAATGGGG - Intergenic
990701289 5:58477527-58477549 ACCAAAGAAAAAGATCAAGGAGG + Intergenic
990749954 5:59003764-59003786 AAGAAAGGAAACAAGCCATGTGG + Intronic
990878487 5:60514833-60514855 GCCAAAGCAATAAAGCAAGGGGG + Intronic
990938363 5:61174491-61174513 AACAAATGAAAAAATGAATGGGG - Intergenic
991156116 5:63438183-63438205 ACAAGAGGAAAAAAGCAAACTGG - Intergenic
991203604 5:64023384-64023406 ACAAAAGCAAAAAAAAAATGTGG + Intergenic
991211839 5:64114844-64114866 GCCAATGGACAAAAGCACTGGGG - Intergenic
991518976 5:67473302-67473324 AGCAAAAGAAAAAAGGAATATGG - Intergenic
991556953 5:67906083-67906105 AGCAAAGGAAGAAACCAATAGGG + Intergenic
992399686 5:76401277-76401299 TCCAAGGGAAAGAAACAATGAGG - Intergenic
992596513 5:78352980-78353002 ACAAAAGGAAAAAAGCTCTGTGG + Intergenic
992611113 5:78509525-78509547 CCCCGAGGAAATAAGCAATGAGG + Intronic
992757171 5:79918610-79918632 AAAAAAAAAAAAAAGCAATGAGG + Intergenic
992900847 5:81293701-81293723 ACAACAACAAAAAAGCAATGGGG + Intergenic
993460408 5:88174974-88174996 AAAAAAAGAAAAAAGAAATGAGG + Intergenic
993665295 5:90688271-90688293 ACCTGAGAAAAACAGCAATGGGG + Intronic
994118371 5:96086524-96086546 ACCAAAGTAGGAAAGCAAAGAGG + Intergenic
994259809 5:97643971-97643993 ACCAATAAAAACAAGCAATGGGG + Intergenic
994271568 5:97783208-97783230 ACCAACGGCAGAAAGTAATGAGG - Intergenic
994364752 5:98900291-98900313 AAAAAAAGAAAAAAGAAATGTGG + Intronic
994489912 5:100427880-100427902 ATCAAATGAAAAAATAAATGAGG - Intergenic
994625373 5:102211866-102211888 GACAAAGGAAAAAGACAATGAGG + Intergenic
994744182 5:103658452-103658474 ACTAAAGGAAGAAAGGAAGGTGG - Intergenic
995581473 5:113607207-113607229 ACCAAAGGAACTAAGCGATTTGG - Intergenic
996208780 5:120778796-120778818 GCCAGAGGAAAAAAGAAGTGGGG + Intergenic
996488218 5:124061593-124061615 ACAAAAGGAAAATAGCACCGAGG + Intergenic
996524368 5:124462417-124462439 ACCACTGGAAAAAAAAAATGAGG - Intergenic
996539479 5:124614239-124614261 AACAAAGCAAAAATGCCATGGGG + Intergenic
996909920 5:128644342-128644364 ATAAGAGAAAAAAAGCAATGAGG - Intronic
997376800 5:133403307-133403329 GCCAGAGGGAGAAAGCAATGGGG - Intronic
998588072 5:143449224-143449246 ACAAAAAGAAATATGCAATGAGG + Intergenic
999048917 5:148500560-148500582 ACCAAAGTTAAAAAGCAAGCAGG + Intronic
999079467 5:148829208-148829230 ACCAAAGGAAAGAAGGAAAAGGG - Intergenic
999559620 5:152786477-152786499 ACAAAAGGTAAAAAACAGTGGGG + Intergenic
999850456 5:155532270-155532292 ACCAAGGTCAAAGAGCAATGAGG - Intergenic
1000285525 5:159823236-159823258 AACAAACGAAAATAGCAATATGG + Intergenic
1000331402 5:160208753-160208775 AAGAAAGAAAAAAAGAAATGGGG - Intronic
1000594559 5:163199450-163199472 ACCAAAGGAGACAAGAAACGTGG + Intergenic
1000945912 5:167422684-167422706 TCCAAAAGAAAAATGCAAAGTGG + Intronic
1000995612 5:167955732-167955754 CCCGATGGAAACAAGCAATGGGG - Intronic
1001059558 5:168477016-168477038 AAGAAATGAAAAAAGCTATGGGG - Intergenic
1001279216 5:170374415-170374437 ACCAGAGGAGGAAAGAAATGAGG - Intronic
1003843269 6:10145204-10145226 ACTAAAAGAAAAAAGCAAGTTGG + Intronic
1003859650 6:10310662-10310684 ACGAAAGGAAAAAAGTTGTGGGG + Intergenic
1004020585 6:11772689-11772711 ACCAGAAGAAAACAGCAATTGGG + Intronic
1005114551 6:22321078-22321100 AACAAGGGAAAAAAGATATGGGG - Intergenic
1005377271 6:25196186-25196208 AGCAAAGGAAAAAAGCCACATGG + Intergenic
1005783977 6:29223178-29223200 GACAAAGGTAGAAAGCAATGGGG - Intergenic
1006821386 6:36898631-36898653 ACAAAAGGTAAAAACTAATGGGG - Intronic
1006893128 6:37446921-37446943 CCCACAGTAGAAAAGCAATGTGG - Intronic
1006967940 6:38008684-38008706 GCAGAAAGAAAAAAGCAATGGGG - Intronic
1008133936 6:47751474-47751496 AACAAAGGAAAAAATTAGTGAGG - Intergenic
1008530939 6:52458078-52458100 ACAAAGGTAAAAAAGCAATTTGG + Intronic
1009192418 6:60645453-60645475 ACCAAAGGGACAAAGAAATGAGG + Intergenic
1009809560 6:68643352-68643374 AACAAAGGTAAAAAGAAATGGGG - Intronic
1010114669 6:72288758-72288780 GCCAGAGGAAGAAAGGAATGTGG - Intronic
1010488504 6:76446275-76446297 AAAAAAAGAAAAAAGAAATGAGG - Intergenic
1010885187 6:81228321-81228343 ACCAAAGAAAGATAACAATGTGG - Intergenic
1010964627 6:82190080-82190102 ACCCAAGGAAAAGAGAAAAGAGG - Intronic
1011174446 6:84544503-84544525 ACCTGACAAAAAAAGCAATGGGG + Intergenic
1011419225 6:87154865-87154887 AACAAAGGAAAAGAACAATTGGG - Intronic
1011444870 6:87427555-87427577 AACAAATGAAAAAATCAATAAGG - Intronic
1011746545 6:90412711-90412733 AGGAAAGGAAAAAAGGAAGGTGG + Intergenic
1011879264 6:92003494-92003516 GACAGAAGAAAAAAGCAATGGGG + Intergenic
1012100128 6:95073493-95073515 ACAAAAAGACACAAGCAATGAGG + Intergenic
1012412163 6:98970966-98970988 ACCAAATGAAAACAAGAATGAGG - Intergenic
1012509978 6:99991825-99991847 AAGAAAAGAAAAAAGAAATGAGG + Intronic
1012688216 6:102278813-102278835 ACCAACAAAAACAAGCAATGAGG - Intergenic
1012830413 6:104197629-104197651 ATCAATGAAAACAAGCAATGGGG + Intergenic
1012955463 6:105565132-105565154 AGGAAAGGAAGAAAGCAAAGAGG + Intergenic
1013455341 6:110324767-110324789 AGAGAAGGAAAAAAGAAATGAGG - Intronic
1013701527 6:112776195-112776217 AAAAAAAAAAAAAAGCAATGGGG + Intergenic
1014021789 6:116599277-116599299 ACCAAATGCATAAAGCAATCTGG - Intergenic
1014110930 6:117617753-117617775 AAGAAAGGAAAAAAGCAAAAAGG + Intergenic
1014406087 6:121052846-121052868 GACAGAGAAAAAAAGCAATGGGG - Intergenic
1014533337 6:122587006-122587028 AACAAACTAAATAAGCAATGTGG + Intronic
1014702341 6:124706100-124706122 ACCAATGGAAAAACCAAATGTGG - Intronic
1015040746 6:128715816-128715838 ACTAAAGGAAAAGAGGAAAGAGG - Intergenic
1015146332 6:129991579-129991601 GCCAAAGGAAGAAGGGAATGAGG - Intergenic
1016551679 6:145287280-145287302 AACAAAGGAATAAAGCTAGGTGG - Intergenic
1016557523 6:145355276-145355298 ACAAAAGGAAAAAACCAACTTGG - Intergenic
1016658907 6:146553017-146553039 AACAAATGAATAAAGAAATGGGG + Intronic
1017193833 6:151680181-151680203 AGAAAAGAAAAAAAGCAAGGTGG - Intronic
1017852510 6:158317162-158317184 AAAAAAGTAAAAATGCAATGTGG - Intronic
1018115911 6:160585182-160585204 ACCAACTGAAAACAGCACTGGGG - Exonic
1018150919 6:160938309-160938331 ACGAAAGGAACAAAGGAATTAGG - Intergenic
1018356633 6:163024338-163024360 GCCAATGAAAACAAGCAATGGGG - Intronic
1018581798 6:165314290-165314312 TCCAAGAGAAAAAAGCAAGGTGG - Intergenic
1018803495 6:167241059-167241081 AGCAATGGAAACAAGCAGTGGGG - Intergenic
1019825040 7:3277265-3277287 AATAAAGAAAAAAAGCAATGTGG - Intergenic
1020815264 7:12897753-12897775 ACCAAAGCAAAAAAGATATATGG + Intergenic
1021255070 7:18382098-18382120 ACCAAAGGAGAAAACCTACGTGG + Intronic
1021501230 7:21334496-21334518 AAGAAAAGAAAAAAGAAATGTGG - Intergenic
1021752155 7:23812994-23813016 AGAAAAGGAAAAAAATAATGGGG - Intronic
1021752798 7:23820911-23820933 ACAAATGGAAAAAGACAATGTGG - Intronic
1021881109 7:25096398-25096420 AAGAAATGAAAAAAGAAATGAGG - Intergenic
1022552124 7:31250995-31251017 ACCAAAGTAAAAAAACAATAGGG + Intergenic
1022557167 7:31310029-31310051 GCCAAAGGAAGAAAACAATAGGG + Intergenic
1022664301 7:32396111-32396133 CCCAAAAGAGAAAAGCTATGAGG + Intergenic
1022793850 7:33716155-33716177 AACAAGGGAACAAATCAATGAGG - Intergenic
1023032161 7:36099229-36099251 ACCAGAGGACAAAAAAAATGGGG + Intergenic
1023798590 7:43814011-43814033 ACCAAGGTAAAAAAGCCGTGGGG + Intergenic
1023855259 7:44179195-44179217 TCAAAAGGATAAAAGAAATGGGG + Intronic
1024389641 7:48793591-48793613 ACAAAGGGAAAAAAGAAGTGTGG + Intergenic
1024838148 7:53548869-53548891 ACAAAAGGAAAATAGCAAATGGG - Intergenic
1025784186 7:64629185-64629207 ACCTAAAAAAACAAGCAATGGGG + Intergenic
1025792156 7:64699112-64699134 ACCCATGGAAAAAAACAAAGAGG - Intronic
1025867979 7:65404188-65404210 TCCAGAGGAACTAAGCAATGGGG - Intergenic
1025965376 7:66265124-66265146 AGAAAAGGAAAAAAGTAATTAGG + Intronic
1026205339 7:68252487-68252509 ACCAAATGAAAAAAATAATTAGG + Intergenic
1026369531 7:69684794-69684816 AGAAAAGGAAACAAGGAATGAGG - Intronic
1027600574 7:80235136-80235158 ACCAAAGAATAAAATCAATAAGG - Intergenic
1028097249 7:86776574-86776596 ACCAAAGGACAAAAGCTGTTGGG - Intronic
1028326885 7:89539292-89539314 AACAAGACAAAAAAGCAATGTGG - Intergenic
1028962556 7:96765632-96765654 ACCAAATGAAACAAGAATTGGGG - Intergenic
1029655944 7:101924546-101924568 AAAAAAGGAAAAAAGTAATTGGG - Intronic
1029964333 7:104723025-104723047 GCAAAATGAAAAAAGCAATAGGG - Intronic
1030135300 7:106241201-106241223 AAAAAAAGAAAAAAGAAATGAGG - Intergenic
1030516596 7:110546144-110546166 ACAAAATGAAAGAAGCAATAAGG + Intergenic
1031649148 7:124264436-124264458 ACTAATGGCAAAAAGAAATGTGG + Intergenic
1031710226 7:125035405-125035427 TCCAAAGGAAGGAAGCCATGTGG - Intergenic
1033027779 7:137793080-137793102 ACAAAAAGAAAAAAGAAAAGAGG - Intronic
1033258472 7:139821871-139821893 ACCAAGGGAAAGTGGCAATGTGG - Intronic
1033614590 7:143001878-143001900 AATAAAGTAAAAAACCAATGTGG - Intergenic
1033626157 7:143111642-143111664 ACCAAAGGCAAGAAGGAATTTGG - Intergenic
1033723420 7:144085954-144085976 AGGAAAGGAAAAAAGCACAGGGG + Intergenic
1034891806 7:154846326-154846348 ACAAAAGGAAATGAGCAAGGGGG - Intronic
1035592471 8:826743-826765 ACCAAAGAAACACAGCACTGAGG - Intergenic
1035827907 8:2664312-2664334 AAAAAAGGAAAAAAACAATTAGG - Intergenic
1036006225 8:4666431-4666453 AGCACAGGAGACAAGCAATGTGG + Intronic
1036276722 8:7358730-7358752 ACCAAAGGGAAAAATCAAGCTGG + Intronic
1036344611 8:7951615-7951637 ACCAAAGGGAAAAATCAAGCTGG - Intronic
1036527029 8:9544855-9544877 GCCAAAGGAAATAGGGAATGGGG - Intergenic
1036839952 8:12112382-12112404 ACCAAAGGGAAAAATCAAGCTGG - Intronic
1036861743 8:12358621-12358643 ACCAAAGGGAAAAATCAAGCTGG - Intergenic
1036947378 8:13106846-13106868 TCCAAAGGAAAATAGCAATTTGG + Intronic
1037029565 8:14087360-14087382 ACAAAAGGAAAGATGCAAAGAGG - Intergenic
1037114316 8:15205460-15205482 ACCAAAGGAAAACATACATGTGG + Intronic
1037152548 8:15655453-15655475 CCCAAAGGGAAAAATCAAGGGGG + Intronic
1038152767 8:24957026-24957048 ACCAAGGGAAAAAATTAAGGAGG - Exonic
1038265012 8:26032357-26032379 ACCCAAAGAAAGAAGCAATAGGG + Intronic
1038854001 8:31311202-31311224 ACTGTAGGAAAAAAGCAATGAGG + Intergenic
1038855494 8:31327382-31327404 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1039134300 8:34302443-34302465 ACAAAAAAAAAAAAGCAATGGGG + Intergenic
1039160930 8:34618861-34618883 AGGAAAGGAAAAAAGAAAGGAGG + Intergenic
1039224809 8:35376957-35376979 ACCAAAGGAAAGCAGAAAAGAGG - Intronic
1039452924 8:37690170-37690192 TCCAAAGGAACAAAGCAGTCAGG + Intergenic
1039590732 8:38744657-38744679 GCCAAAGGAATTGAGCAATGGGG - Intronic
1039722258 8:40176767-40176789 AATAAAGGAAAAAAGCAAGCAGG + Intergenic
1040096076 8:43444236-43444258 AACAAAGGAAATAAGCAAAATGG - Intergenic
1040484821 8:47859908-47859930 AAGAAAGCAAAAAAGAAATGGGG + Intronic
1040753324 8:50738789-50738811 ACAAAAAAAAAAAAGCAATGGGG + Intronic
1040921568 8:52626224-52626246 CTCAAAGGAAAAAAGGAACGGGG + Intronic
1042443371 8:68853677-68853699 ACAAAATAAAAACAGCAATGTGG + Intergenic
1042610061 8:70588793-70588815 AACAAAGGAAATTAGAAATGAGG - Intronic
1042977139 8:74481912-74481934 GACAAAGGAATAAAACAATGGGG + Intronic
1043139947 8:76575607-76575629 ACTTAAGCCAAAAAGCAATGTGG + Intergenic
1043272809 8:78355375-78355397 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1043452832 8:80385250-80385272 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1043483660 8:80677647-80677669 GCAAAAGGAAAAAAGGAAAGAGG - Intronic
1043869317 8:85413917-85413939 GCCAAGGGAAGAAAGAAATGGGG - Intronic
1044765465 8:95568074-95568096 AGCAAAGGAAACAATCAATATGG + Intergenic
1045669206 8:104528472-104528494 GCCACAGAAAAAATGCAATGAGG + Intronic
1046232794 8:111379564-111379586 ACCAAAGAAAAAAATCACAGAGG - Intergenic
1046285370 8:112086678-112086700 ACCTGACAAAAAAAGCAATGCGG + Intergenic
1046530699 8:115441711-115441733 ATTAAAGGCAAAAAGTAATGTGG + Intronic
1046745347 8:117869969-117869991 GACAAAGGAAGAAAACAATGAGG + Intronic
1046822794 8:118652589-118652611 ACTAATGGGAAAAAGCAAGGAGG + Intergenic
1047348054 8:124047693-124047715 TCTAAAGGGAAAAAGAAATGTGG + Intronic
1047456265 8:125015669-125015691 ACAAAAGTTAAAAAGCAAGGAGG - Intronic
1047484807 8:125319843-125319865 TCCAAAAGAAGAAAGCTATGAGG + Intronic
1047835606 8:128687392-128687414 ACCAACAGAAACAAGTAATGAGG - Intergenic
1049051684 8:140202166-140202188 AAAAAAAAAAAAAAGCAATGAGG + Intronic
1050224929 9:3442650-3442672 ACAAAAGGAGAAAAGGAATGGGG + Intronic
1050647457 9:7736198-7736220 ACCTAAGGAAAATAGAAAGGTGG + Intergenic
1050813492 9:9779091-9779113 AAAAAAAAAAAAAAGCAATGGGG + Intronic
1050869491 9:10549367-10549389 ACTAAAGGAAAAAAGGAAAGGGG + Intronic
1050923707 9:11236876-11236898 ACCAACAAAAACAAGCAATGGGG - Intergenic
1051661564 9:19431704-19431726 ACCAGAGGAAAAAATATATGTGG - Intronic
1052701981 9:31949013-31949035 ACCAACAAAAACAAGCAATGGGG + Intergenic
1053133088 9:35629969-35629991 ATCAAATGAATAAAGCAAAGGGG - Intronic
1053315135 9:37044532-37044554 ACCAAAGGAGAAATGCATTTAGG - Intergenic
1053435618 9:38072057-38072079 CCCAAAGGAAAACACCCATGTGG - Intergenic
1054924621 9:70576888-70576910 AGCAAGGGCAAAAAGCCATGTGG - Intronic
1054936214 9:70691590-70691612 AATAAGGGAAAAAAGGAATGAGG - Intronic
1055060822 9:72066790-72066812 AAAAAAGGAAAAAAGAAATAAGG + Intronic
1055106412 9:72518054-72518076 ACAAAAGGATAAAAGGAAGGAGG - Intergenic
1055129438 9:72757841-72757863 ACCAAAGGCAAACAGCTATTAGG + Intronic
1055592174 9:77828463-77828485 CCCAAAAGAAAAAAGTAATTAGG - Intronic
1055677513 9:78679912-78679934 ACCCAAGAACAAAAGCAATAGGG + Intergenic
1055904747 9:81279727-81279749 ACCAAGAGAAAAAAGAAATGGGG + Intergenic
1056339223 9:85608431-85608453 ACCAAATGACATAATCAATGTGG + Intronic
1057434354 9:95025609-95025631 ACAAAACGAAAATACCAATGTGG - Intronic
1057461010 9:95261917-95261939 ACCAAGGGAAACCAGCCATGGGG + Intronic
1057701222 9:97364428-97364450 AATAAAGGAAAAGAGAAATGGGG - Intronic
1058264360 9:102879502-102879524 AACAAAGGAAAAAAATAATAAGG - Intergenic
1058432123 9:104928564-104928586 AACAAAGGAAAAAAAAATTGCGG - Intergenic
1058649955 9:107166495-107166517 AAGAATGGAAAAAAGAAATGAGG + Intergenic
1059049993 9:110914019-110914041 ACCAAAGGAAAAAAGCAATGAGG - Intronic
1059301377 9:113316339-113316361 ACAAAAGAAAAAAGGCAGTGGGG - Exonic
1059667073 9:116457379-116457401 AGCAAAGGAAACAATCAATAAGG + Intronic
1059735261 9:117094089-117094111 ATCAAAGGAAGAAAGAAAGGAGG + Intronic
1060137849 9:121174710-121174732 AGAAAAGGAAAAAAGAGATGAGG + Intronic
1060543155 9:124445240-124445262 AGAAAAGGAAAAAAGGAAAGAGG + Intergenic
1060783738 9:126433003-126433025 TCCAAAGGAAAAAAGGAATAGGG + Intronic
1062515260 9:136930649-136930671 ACGAAAAGAAAAAAGGAAGGAGG - Intronic
1203370366 Un_KI270442v1:297957-297979 AACAATGGAGAAAAGAAATGTGG - Intergenic
1203566408 Un_KI270744v1:94261-94283 AATAAAGGAATAAAGAAATGTGG + Intergenic
1185552657 X:996184-996206 GCCAAAGGAAAAAGTCAATATGG - Intergenic
1186069966 X:5808825-5808847 AAAAAAGGAAAAAAGGAAGGAGG - Intergenic
1186091096 X:6049712-6049734 ACAAAAGGAAAAATAAAATGGGG + Intronic
1186392789 X:9178015-9178037 ACCAAAGGAAGAATTCAAGGTGG + Intergenic
1186517696 X:10178667-10178689 ACCAAAGGAAAACAGACATCAGG - Intronic
1186830647 X:13386805-13386827 ATCAAAGGAAAGTAGCCATGTGG + Intergenic
1187278072 X:17833781-17833803 ACAAAAATACAAAAGCAATGGGG + Intronic
1187624395 X:21094170-21094192 ACAAAAAAAAAAAAGAAATGGGG + Intergenic
1187739110 X:22336100-22336122 ACTAAAAGAAAAAAGCACAGTGG - Intergenic
1188082091 X:25855808-25855830 ACCAAAGGATAAAAGATATCTGG - Intergenic
1188125474 X:26363019-26363041 ACCAAAAGAAAAAAGAAAAAGGG + Intergenic
1188203232 X:27318868-27318890 ACCAAAGGAAGAAAGCAGATAGG + Intergenic
1188278403 X:28231442-28231464 GACAAATGAAAATAGCAATGAGG - Intergenic
1188931789 X:36120307-36120329 AACAAAATAAAAAGGCAATGTGG - Intronic
1189061569 X:37759105-37759127 TACAAAGGGAAACAGCAATGAGG - Intronic
1189952977 X:46251235-46251257 AAAAAAAAAAAAAAGCAATGTGG + Intergenic
1191137155 X:57077275-57077297 ACAAAAGCATAAAAGCTATGAGG - Intergenic
1191208652 X:57861269-57861291 CCAAAAAAAAAAAAGCAATGGGG + Intergenic
1191253561 X:58270416-58270438 ATCCAGGGAAAAAAGCAGTGAGG - Intergenic
1191573151 X:62658776-62658798 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1191728811 X:64311759-64311781 AAAAAAAAAAAAAAGCAATGGGG - Intronic
1191817221 X:65259290-65259312 GCCAATGAAAACAAGCAATGAGG + Intergenic
1191831939 X:65424731-65424753 ACCTGACAAAAAAAGCAATGGGG - Intronic
1192035818 X:67561877-67561899 CCCAAAGGGCAAAAGCAATGAGG + Intronic
1192099604 X:68250118-68250140 AACATAGGAAAAGAGCAATGAGG - Intronic
1192593440 X:72381816-72381838 AGCAAAGAAAATAAGAAATGAGG + Intronic
1192660599 X:73037963-73037985 ATCAAAGTACACAAGCAATGTGG - Intergenic
1193035102 X:76941371-76941393 ACTATACAAAAAAAGCAATGGGG + Intergenic
1193035322 X:76944252-76944274 ACAAAAAAAAATAAGCAATGGGG - Intergenic
1193252201 X:79304625-79304647 ACCAACCAAAACAAGCAATGAGG + Intergenic
1193280743 X:79646481-79646503 AAAAAAAAAAAAAAGCAATGAGG - Intergenic
1193439781 X:81525397-81525419 ACCAACAAAAACAAGCAATGGGG - Intergenic
1193634164 X:83927626-83927648 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1193642218 X:84023907-84023929 AAAAAAAAAAAAAAGCAATGGGG - Intergenic
1193767788 X:85552065-85552087 ATCAAAGGAAACAATCAATAGGG - Intergenic
1194645241 X:96451164-96451186 AACAAATGAAACAGGCAATGTGG + Intergenic
1194706857 X:97185989-97186011 ATAAAAGAAAAAAAGGAATGAGG - Intronic
1194710233 X:97227286-97227308 ACAAAATCAATAAAGCAATGTGG + Intronic
1194747954 X:97650030-97650052 ACCAAAAGAAAAAAAAAATGAGG - Intergenic
1195092570 X:101475348-101475370 TGCAAAAGAAAAAAGCTATGAGG + Intronic
1195140553 X:101955053-101955075 ACCTGACGAAAACAGCAATGGGG + Intergenic
1195489020 X:105444302-105444324 AGCAAAGGAAAAAATCAACAAGG - Intronic
1195619328 X:106937388-106937410 ACCAAAGGAGAACAGGAATGTGG - Intronic
1196053278 X:111328193-111328215 AAAAAAGAAAAAAAGAAATGAGG - Intronic
1196103058 X:111867509-111867531 ACCACAGGGAAAAAGCAAAGTGG - Intronic
1196256013 X:113519997-113520019 ACCAAAAGAAAAATCCAAAGAGG - Intergenic
1196584477 X:117413893-117413915 AACTAACAAAAAAAGCAATGGGG + Intergenic
1196918581 X:120563220-120563242 ACAAAATGAAAAAAACTATGTGG - Intronic
1197253239 X:124236234-124236256 ACCACAGGATAAACACAATGTGG + Intronic
1197395020 X:125916854-125916876 AAAAAAAAAAAAAAGCAATGGGG - Intergenic
1197643051 X:128987261-128987283 ACGAATGGATAAAAGAAATGTGG - Intergenic
1197900194 X:131363247-131363269 CCCAAATGAAAAAATCAATTTGG - Intronic
1198147541 X:133872553-133872575 ACCAAAGGCCCAAAGCAATATGG - Intronic
1198820265 X:140639836-140639858 ACCAAAGGAAACTCTCAATGAGG - Intergenic
1198993790 X:142548609-142548631 AACAAACAAAAAAACCAATGGGG + Intergenic
1199139338 X:144290780-144290802 ACCATATGAGAAAAGCAAAGAGG - Intergenic
1199174556 X:144770981-144771003 AGCAAAGGAAACAATCAAAGTGG - Intergenic
1199701513 X:150380724-150380746 ACAAAAAGAAAAAAGGAAAGAGG - Intronic
1199866591 X:151855624-151855646 ACCAAAATAAATAATCAATGGGG + Intergenic
1199888805 X:152052821-152052843 ACCAAACAAAAAAAGCCCTGTGG - Intergenic
1200543109 Y:4484554-4484576 GCCAAAGGGGAAAATCAATGTGG + Intergenic
1201855834 Y:18540426-18540448 AATAAAGCAAAAAAACAATGCGG - Intergenic
1201877487 Y:18779959-18779981 AATAAAGCAAAAAAACAATGCGG + Intronic
1202079338 Y:21068476-21068498 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1202579469 Y:26364462-26364484 AGCAAAGGAAAAAAAGAATATGG + Intergenic