ID: 1059058998

View in Genome Browser
Species Human (GRCh38)
Location 9:111015196-111015218
Sequence GCCATGAAGTCCCACGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059058998 Original CRISPR GCCATGAAGTCCCACGGACT GGG (reversed) Intronic
901145613 1:7062677-7062699 GCCATGAAGTCCCATAAATTGGG + Intronic
902876094 1:19341803-19341825 GCACTTAAGTCCCACGGCCTCGG + Intronic
904414561 1:30350223-30350245 GCCATAAAATACCACAGACTGGG + Intergenic
906460334 1:46031401-46031423 GCTGTGAGGTCCCACGGCCTCGG - Exonic
908183854 1:61632912-61632934 GCCATGATGTCCCATGGGATTGG - Intergenic
910063595 1:83124363-83124385 GTAATGAAGTACCACAGACTGGG + Intergenic
910600203 1:89023192-89023214 GGCATTAAGTGCCAGGGACTAGG - Intergenic
1063559596 10:7113903-7113925 GTAATGGAGTACCACGGACTGGG - Intergenic
1067741399 10:48898355-48898377 GCCCTGGAGGCCCAGGGACTGGG - Intronic
1069610745 10:69770962-69770984 GCCATGAAGTCTGAAGGTCTGGG - Intergenic
1070736443 10:78866704-78866726 GCCACTAAGTCCCACTGAATGGG + Intergenic
1071770806 10:88727419-88727441 ACCATGAAATCACACAGACTTGG - Intronic
1072889054 10:99305351-99305373 GCCATGAAGTACCACTTCCTAGG + Intergenic
1074091194 10:110257820-110257842 GCCATGAATTCACAGGGAATAGG - Intronic
1074673331 10:115820724-115820746 GCTCTGAAGTCACACTGACTTGG + Intronic
1075241631 10:120784566-120784588 GCCATAAAGTGCCACAGACTGGG - Intergenic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1075752774 10:124787069-124787091 GCCATATAGTCCCAGGTACTCGG - Intronic
1076979088 11:195800-195822 CCCATGAAGTCCCCCTCACTGGG - Intronic
1078933433 11:15930673-15930695 GCCGTGAAGCCCCACTGTCTTGG + Intergenic
1083094064 11:60231861-60231883 TCCAAGAAGTCCCACAGATTAGG + Intronic
1084871281 11:72100134-72100156 GCCCTGCAGTCCCACCTACTTGG + Intronic
1088138444 11:106585650-106585672 GAGATGAAGTCCCATGGAATGGG - Intergenic
1090976577 11:131684799-131684821 GACATGGAGTCCCAAGGAGTTGG - Intronic
1091255982 11:134186031-134186053 GCCATGTAGTCCCAGCTACTCGG - Intronic
1091920771 12:4302965-4302987 CCCAAGGAGTCCCACGGAATGGG + Exonic
1097516691 12:60616489-60616511 TCCATGAAGACCCAAGGGCTAGG + Intergenic
1098952977 12:76660861-76660883 GCCATGAATTCACAGGGAATAGG - Intergenic
1099977791 12:89564454-89564476 GCCATAAAATACCACAGACTGGG + Intergenic
1102596274 12:113994901-113994923 GCAATGTAGTCCCACCTACTTGG - Intergenic
1102916292 12:116755396-116755418 GCCATGAATTCACAGGGAATAGG + Intronic
1113292174 13:108919227-108919249 GCCATGCAGTCCCATGGCCCTGG + Intronic
1115633483 14:35268217-35268239 GCCTTGTAGTCCCAGGTACTCGG + Intronic
1117740531 14:58814708-58814730 GCCATAAAGTCCCAAAGTCTGGG - Intergenic
1118387296 14:65266642-65266664 GCCATGAATTCACAGGGAATAGG + Intergenic
1120989963 14:90366701-90366723 GCCATGAATTCACAGGGAATAGG + Intergenic
1122358146 14:101136585-101136607 GCCATGAGCTCCCACAGACAGGG - Intergenic
1122639427 14:103149380-103149402 GCCATGAATTCACAGGGAATAGG - Intergenic
1123853289 15:24381939-24381961 GCCATAAAGTCCCAGAGAATGGG - Intergenic
1126078795 15:44938585-44938607 GGCATGTAGTCCCACCTACTCGG + Intergenic
1128558471 15:68647900-68647922 GCCCTGAAGTCCCAGCTACTTGG + Intronic
1131625620 15:94117024-94117046 GCCATGTAGTCCCAGCTACTTGG - Intergenic
1131651549 15:94404784-94404806 ATCATGAAGCCCCACAGACTCGG - Intronic
1137781517 16:51101489-51101511 GCCATAAAGTACCATAGACTGGG - Intergenic
1140705333 16:77623628-77623650 GCCCTGTAGTCCCAGGTACTTGG - Intergenic
1141259160 16:82435354-82435376 GCCATGAATTCACAGGGAATAGG - Intergenic
1141875560 16:86821821-86821843 GGCAGGAAGTCCCAAGGACATGG + Intergenic
1141907448 16:87036605-87036627 GCCATAAAGTCCCACAGACTGGG - Intergenic
1142032143 16:87843941-87843963 GACATGAAGCCCCAGGCACTGGG + Intronic
1142466578 17:140618-140640 CCCATGAAGTCCCCCTCACTGGG - Intergenic
1143689274 17:8547173-8547195 GCCATGTAGTCCCAGCTACTCGG - Intronic
1145309144 17:21692014-21692036 TCCATTAAGTCCCACGAACAGGG - Intergenic
1157452075 18:47796295-47796317 GCCTTGTAGTCCCAGGTACTCGG + Intergenic
1163646545 19:18492876-18492898 GCCGTGAAGTCCCACTGGCCAGG + Intronic
1165310996 19:35029709-35029731 GCCATGGAGGCCCACGGAGAGGG + Intergenic
1166038279 19:40185722-40185744 GCCATAAAGTACCACAAACTGGG + Intergenic
1167218734 19:48183252-48183274 GCCCTGTAGTCCCAGGTACTCGG - Intronic
1168004929 19:53479058-53479080 GGCCTGTAGTCCCACGTACTCGG - Intronic
925850241 2:8074359-8074381 GTCATGAAATCCCAAAGACTGGG + Intergenic
927251693 2:21000443-21000465 GCCATGAAGCCCCTGGGGCTAGG + Intergenic
928642285 2:33312920-33312942 GGCATGAAGTTCCACTGGCTTGG - Intronic
933835675 2:86243465-86243487 GCCAGGAATTCACACGGAGTTGG - Intronic
936084152 2:109455170-109455192 GCCATGACCTCCCAGGGACTAGG - Intronic
938983331 2:136547702-136547724 GCCATTAAGTCGCAGGGACAGGG + Intergenic
941635953 2:167934998-167935020 GCCATAAAGTACCACAAACTGGG - Intergenic
941712311 2:168727074-168727096 CCCATGAAGTGCCAAGGCCTTGG + Intronic
942689755 2:178572909-178572931 GCCATGAATTCCGAAGGACTTGG - Exonic
946388218 2:219399088-219399110 TCTATGAAGTTCCAGGGACTGGG + Intronic
948437225 2:237961912-237961934 GCCATAAAATACCACAGACTGGG - Intergenic
1171457794 20:25281706-25281728 GCCCTGAAGTCCTGCGGTCTCGG + Intronic
1172934264 20:38608609-38608631 GCCCTGAAGTCACACTGTCTGGG - Intronic
1175331784 20:58169605-58169627 GCCCTCAAGTCCCATGGACATGG - Intergenic
1175761155 20:61562878-61562900 GCCGTGAAGACTCAGGGACTGGG - Intronic
1176043967 20:63082967-63082989 GCCATGAGGTCCCAAGGAGGGGG + Intergenic
1178251609 21:31008713-31008735 GTCATGAAGTCGCACAGACTGGG - Intergenic
1183744321 22:39684561-39684583 GCCTGGAAGTCCAAGGGACTGGG + Intronic
955501603 3:59590273-59590295 GCTATGAAGTCCACCGGCCTGGG - Intergenic
960168189 3:114427972-114427994 GCCATAAAGTCACGGGGACTGGG + Intronic
961945167 3:130679402-130679424 GTCATGATGTCCCACGGGCAGGG + Exonic
964024307 3:152053793-152053815 GCTAGGAAGTCTCAAGGACTAGG - Intergenic
966317131 3:178660398-178660420 GCCATGAAGCCCAACCCACTTGG + Intronic
973748348 4:53986591-53986613 GCCATGAATTCACAGGGAATAGG + Intronic
973897497 4:55429334-55429356 GCTATGGAGTCCCACAGGCTAGG - Exonic
975943337 4:79674708-79674730 GCCTTGTAGTCCCAGGTACTCGG - Intergenic
976649257 4:87417637-87417659 GCCAAGTAGTCCCACCTACTCGG + Intergenic
980689877 4:136281461-136281483 GCCATGAAGTTCTACACACTGGG + Intergenic
982211624 4:153041421-153041443 GCCAGGAAATCCCAAGGAGTTGG + Intergenic
986078025 5:4358041-4358063 GACCTGAAGTCTCATGGACTTGG - Intergenic
986308506 5:6533186-6533208 GTCATGAAGTGCCATGGGCTGGG + Intergenic
987663377 5:20905777-20905799 GCCCTGTAGTCCCACTTACTTGG + Intergenic
988759307 5:34296409-34296431 GCCCTGTAGTCCCACTTACTTGG - Intergenic
996298022 5:121946973-121946995 GCAATGAAGTACCAAGGGCTGGG - Intergenic
1001651447 5:173318908-173318930 GCAATGACGTCCCAGGGACATGG - Intronic
1004124828 6:12863182-12863204 GCAATGAAGTACCACAGACTGGG + Intronic
1007271844 6:40643752-40643774 GCTATGGAGTCATACGGACTGGG - Intergenic
1010209672 6:73353336-73353358 GCCATGAATGCCCTCGAACTAGG - Exonic
1013061913 6:106642902-106642924 GCCATGAATTCACAGGGAATAGG - Intronic
1017866864 6:158451502-158451524 GCCATGATGGACCATGGACTTGG - Intronic
1018150614 6:160933896-160933918 GCCAGAAAGTTCCAGGGACTGGG - Intergenic
1018435323 6:163753817-163753839 GTCATGAAGAACCACAGACTGGG + Intergenic
1019421620 7:953739-953761 GCCTTGAAATCCCACAGACCTGG + Intronic
1023040246 7:36166909-36166931 ATAATGAAGTCCCACAGACTGGG + Intronic
1026931680 7:74226344-74226366 GCCCTAGAGTCCCACTGACTTGG + Intronic
1029961934 7:104696889-104696911 GCCACAAAGTCCCACAGACTAGG + Intronic
1030288679 7:107850821-107850843 TCCATGAGGCCCCATGGACTGGG + Intergenic
1041600460 8:59711569-59711591 GCCATAAAATACCACAGACTGGG - Intergenic
1043481400 8:80656346-80656368 GCCATAAAATACCACAGACTTGG - Intronic
1043512319 8:80961715-80961737 GCCCTGTAGTCCCAGCGACTTGG + Intergenic
1045236827 8:100359415-100359437 TCCATGAAGTCACAAGGACTTGG + Intronic
1048996837 8:139799784-139799806 GCCCTGCAGTCCCACGGGCTGGG + Intronic
1053042315 9:34885189-34885211 GCCATGAAGTCACAAGGTCTAGG - Intergenic
1055076321 9:72218797-72218819 GTCATGAAGTCCTATGCACTTGG - Intronic
1057308759 9:93928207-93928229 ATCATGAAGCACCACGGACTGGG + Intergenic
1059058998 9:111015196-111015218 GCCATGAAGTCCCACGGACTGGG - Intronic
1062095931 9:134703374-134703396 GCCTTGGAGTCACACAGACTGGG + Intronic
1185636362 X:1554874-1554896 GCCGTAAAGTCCCAGGCACTCGG + Intergenic
1188470289 X:30530404-30530426 ACCATGAAGTCCCTGGGCCTGGG + Intergenic
1189965793 X:46371392-46371414 GCCATGTAGTCCCAGCTACTTGG + Intergenic
1190421003 X:50284393-50284415 GCTATAAAGTGCCATGGACTGGG + Intronic
1194806123 X:98330362-98330384 GCCATGAAGGCCTAAGGCCTAGG - Intergenic
1199543074 X:148979200-148979222 GCCAAGAGGTCTCACGCACTTGG - Intronic
1200255373 X:154579478-154579500 GTCATTAGGTCCCACGGCCTAGG - Intergenic
1200262396 X:154624926-154624948 GTCATTAGGTCCCACGGCCTAGG + Intergenic