ID: 1059059023

View in Genome Browser
Species Human (GRCh38)
Location 9:111015394-111015416
Sequence CAGTGGGTTTGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 1, 2: 7, 3: 52, 4: 586}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059059023 Original CRISPR CAGTGGGTTTGGAGGGAAGA AGG (reversed) Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901874335 1:12158372-12158394 GAGTGGGTTTGGAGGGGTTACGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
904926492 1:34053025-34053047 AAGTGGCTTTGGAAGGAAGAGGG + Intronic
905744347 1:40401364-40401386 CACAGGATTTGGATGGAAGATGG + Intronic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906616263 1:47234932-47234954 AATTGGGTTTGGGGGGATGAGGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907273118 1:53302255-53302277 CAGTGCGTTTGGAAGGAAATGGG + Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907494687 1:54836083-54836105 CAGAGGGGTTTGAGGGGAGAAGG - Intronic
907757973 1:57329278-57329300 CATGGGCTTTGGAGGGAGGAAGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
908819162 1:68065791-68065813 AAGTTGGTTTGCAGGGAACAAGG - Intergenic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912998739 1:114558193-114558215 CAGTGAGTTTGGAAGGAAACTGG + Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913264051 1:117027173-117027195 CAGCGGGTTTGGAGGCATAAGGG - Intronic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
914667988 1:149847929-149847951 TAGTGGGTTTGGAGAGAGCATGG + Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
916287187 1:163121099-163121121 TACTGGGGTAGGAGGGAAGAAGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
918422385 1:184377160-184377182 GAGTGGATTTTGAGGGAACATGG + Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919705345 1:200670024-200670046 CAGTGGCTTGGGAGGGAGGGAGG + Intergenic
920550188 1:206854097-206854119 TAGGGGGTTTGGGGGGAAGGGGG + Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921340584 1:214129851-214129873 CAGTGGGTTAAGATGTAAGAAGG + Intergenic
922696742 1:227734856-227734878 CAGACGGTTTGGAGTGAGGACGG - Intronic
922851419 1:228736214-228736236 GAGTGGGCTTGGAGAGAGGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923649858 1:235864342-235864364 GAGTAGGTTTGGTGGGGAGAAGG - Intronic
924275461 1:242381777-242381799 CCGTGGGTTTGGAGTTAAGTGGG - Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063282198 10:4642435-4642457 TAGTGGGGTTGGGGGGTAGATGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064017760 10:11786017-11786039 CAGAGGGTTTTCAGGCAAGAGGG - Intergenic
1064078180 10:12287022-12287044 TACTTGGTTTGGAGGGAAAAAGG - Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064341649 10:14491003-14491025 CAGTGACTTGGGAGGGAGGAGGG + Intergenic
1064599062 10:16974776-16974798 GAGTGGGTTGGGGAGGAAGAGGG - Intronic
1065510191 10:26470770-26470792 CCGTGGGTTTGGATAGAAGCAGG - Intronic
1065673171 10:28144495-28144517 CAGTGGCTTGCGAAGGAAGAAGG - Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067083637 10:43227085-43227107 CAGTGGGTTAAGGGGGAAAAGGG + Intronic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067529249 10:47058623-47058645 CAGTGCATTTGGAGGGAAACTGG - Intergenic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067749641 10:48962280-48962302 AAGTGGCTTTGGAGCCAAGAAGG - Intronic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1070080701 10:73183857-73183879 CAGTAGGTTTGGAGTGAACCTGG + Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070726332 10:78793724-78793746 CAGTGAGTGTGGCAGGAAGAAGG - Intergenic
1071176837 10:82936443-82936465 CATAGGGTTTAGGGGGAAGATGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071511582 10:86265632-86265654 CATAGAGGTTGGAGGGAAGAGGG + Intronic
1071889516 10:89987815-89987837 GAGTAAGTTTGGGGGGAAGAGGG - Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073838927 10:107475894-107475916 TAGAGGGTTTGAAGGGAAAAAGG - Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075206600 10:120454657-120454679 AAGTGGTTTTGGAGGGCAAAAGG - Intergenic
1075339311 10:121632903-121632925 CAGTGGGTTTGCAGGCCAGGAGG + Intergenic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076485901 10:130816786-130816808 CAGTGGGTTTGGAAGGAGTCAGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1077587064 11:3461989-3462011 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1079949339 11:26782934-26782956 CAATGGGGTGGGAGGGATGAAGG - Intergenic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080663923 11:34319221-34319243 CGGTGGGGTTGTGGGGAAGAAGG - Intronic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1082003012 11:47404101-47404123 CAGTTGGTTTGGAGGCCATAGGG - Intergenic
1082274017 11:50201944-50201966 GGGTAGGTTTGCAGGGAAGATGG - Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1084253718 11:67923425-67923447 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084829930 11:71760941-71760963 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1084857311 11:71997478-71997500 CATTGGGTTTCTAGGGAATATGG + Exonic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1088589742 11:111393158-111393180 CAGTGGATTTGGAGGAAACTTGG - Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089610908 11:119668187-119668209 GAGAGGGTTTAGAAGGAAGATGG - Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090114629 11:123955489-123955511 CAGGGGGTTGGGTGGGAGGAAGG + Intergenic
1090589366 11:128248868-128248890 TAGTAGGTTTTGAGAGAAGAGGG + Intergenic
1090743910 11:129691926-129691948 TAGTGGGTTTTGAGGGAACTGGG - Intergenic
1091081570 11:132673907-132673929 TAGTGGGTTAGGAGAGAAAAGGG - Intronic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1091300480 11:134504065-134504087 GAGTGGGCTTGGAGGGATGCTGG + Intergenic
1092203166 12:6599831-6599853 CAGTGGATGTGGTAGGAAGAAGG + Exonic
1092280843 12:7096708-7096730 CAGTGGGTTTGGCATGGAGATGG - Exonic
1092288595 12:7144751-7144773 GGGTGGGTTTAGAGGGGAGAGGG + Intronic
1092413305 12:8270736-8270758 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1092423791 12:8356812-8356834 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094640960 12:32275334-32275356 CAGTGGTTTGGGAGTGAGGATGG + Intronic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096351104 12:50902149-50902171 CAGAGGGTTTGGTTGCAAGATGG - Intergenic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096607027 12:52774232-52774254 CACTGCATTTAGAGGGAAGAGGG - Intronic
1096806800 12:54145852-54145874 CAGTTGGTTTGGTGTGGAGAAGG - Intergenic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098450495 12:70613150-70613172 CAGTGGTGTTGGATGGATGAGGG + Intronic
1099015481 12:77338922-77338944 GGGTGAGTTTGGAGGGAAAAAGG + Intergenic
1099054268 12:77818552-77818574 CAGTGTCTTTGCAGGGATGAGGG + Intergenic
1099669896 12:85676922-85676944 CAGTGGTTTTTGAGTGAATAAGG - Intergenic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101046774 12:100814788-100814810 CACTTGGTTTGAAGTGAAGATGG - Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103972674 12:124681912-124681934 CAGGGGCTTTGGAGGGAGCAGGG - Intergenic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1104715919 12:131016114-131016136 CAGAGGGCTTGGAGGAGAGAAGG - Intronic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105213956 13:18273711-18273733 CAGTGAGTTTTGAGGGTGGAGGG - Intergenic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106506871 13:30378165-30378187 GAGCGGGTTTGGAGAGAAGATGG + Intergenic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1110474000 13:75891941-75891963 TGGTGGGTTTGGAGAGAGGAGGG - Intergenic
1110585754 13:77189896-77189918 AAGTGAGATTGCAGGGAAGATGG - Intronic
1110590530 13:77251875-77251897 CAGGGTGTTTGGAGAGCAGAGGG - Intronic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1110866937 13:80407109-80407131 CAGAGCATTTGGAGGGAACATGG - Intergenic
1111808720 13:93070536-93070558 CAATTGTTTTGAAGGGAAGAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1114893279 14:26952739-26952761 CACTGTGTTTGCAGGAAAGATGG + Intergenic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1116385844 14:44328847-44328869 CAGGGGACTTGGAGGGGAGAGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117483328 14:56170159-56170181 CAGTTGCTTTGGAAGGAAGGCGG + Intronic
1117951709 14:61089524-61089546 CAGTGGCTTAGGTGGGAGGAGGG + Intergenic
1118536388 14:66771063-66771085 CAGTGGCTTAGGAAGGATGAAGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120862479 14:89267196-89267218 CAGTGGGTTCTCAGGGTAGACGG + Intronic
1121047072 14:90796110-90796132 CAGCTGGTTGGGAGGGAAGCTGG - Intronic
1121453257 14:94022862-94022884 CAGTGGGATTGGGGGGATTAGGG - Intergenic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121677393 14:95765105-95765127 CAGCTGGTTTGGGGGGTAGATGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1124119511 15:26876692-26876714 CAGTGAGTTTTCATGGAAGACGG + Intronic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1129162572 15:73754742-73754764 AATTGGTTTTGGAGGGTAGAAGG + Intergenic
1129794201 15:78363614-78363636 CCTTGAGTTAGGAGGGAAGACGG + Intergenic
1129898792 15:79129745-79129767 CAGTGGGTTTGGAGGGGCATAGG - Intergenic
1129919535 15:79308715-79308737 CAGTGTGTTTAGTGGGAAGCTGG + Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130760001 15:86809343-86809365 CAGGGGCTTTTGAGGGTAGAAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131147860 15:90026450-90026472 CAGTGTCTTTGGTGGGTAGAGGG - Intronic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131963638 15:97814655-97814677 AAGTGGGTTTGGAGGGTGCAAGG + Intergenic
1132008437 15:98252559-98252581 CAGTGGGCTTGGAGGTGTGAAGG - Intergenic
1132106521 15:99066752-99066774 TAGTGGGCTTGGAGGGTAGGTGG + Intergenic
1132193536 15:99891205-99891227 CAGTGGATTTGTAGGGATGAAGG - Intergenic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133149153 16:3813914-3813936 CATTTGGTGTGGAAGGAAGATGG - Intronic
1133354516 16:5126241-5126263 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1134133114 16:11663224-11663246 CAGTGAGTTTGTAGGGGGGAAGG + Intergenic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134426138 16:14147583-14147605 CAGTGTGTTTGGAGCGAGGGAGG + Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1136105278 16:28025774-28025796 CAGTGTGTTGGGACAGAAGAGGG + Intronic
1136667468 16:31824810-31824832 CCGAGAGTTTGGAGAGAAGAAGG + Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137515637 16:49141083-49141105 CACTGGGGTGGGAGGGAGGACGG - Intergenic
1137638790 16:50010361-50010383 CACTGTGTTTGGAGGGAGGATGG + Intergenic
1137976195 16:53034197-53034219 CATTGGGTTTTCTGGGAAGAGGG - Intergenic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141700637 16:85640500-85640522 CACTGGCTTTGCAGGCAAGAGGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141881812 16:86865312-86865334 CAGGGGGTTGGGTGGGAAGGCGG - Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143790676 17:9292887-9292909 CCTTGTGTTTGGAGAGAAGATGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144665458 17:17099025-17099047 GAGGGGCTTTGGAGGGAGGAGGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1147370114 17:39986757-39986779 CAAGGGGTTTGGCGGGGAGATGG + Intronic
1147394491 17:40131135-40131157 TAGTTTGTTTGGAGGGAGGAGGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1149061928 17:52432914-52432936 CAGTGACTTTGGAGAGAACAGGG + Intergenic
1149109135 17:53005848-53005870 CAGTGGAGTTGGAAGGGAGAAGG + Intergenic
1151009684 17:70480289-70480311 CAGTTGATTTGGAGTGAGGAAGG + Intergenic
1151153617 17:72109055-72109077 GAGTGGGTTAGAAAGGAAGAGGG - Intergenic
1151320730 17:73350829-73350851 CAGGAGATTTGGAGGGAGGAGGG - Intronic
1151345212 17:73497263-73497285 CAGTGTCTTGGGAGGAAAGAGGG - Intronic
1152175045 17:78782003-78782025 CAGGGGGTTTTGAGGGATGAGGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152272221 17:79331388-79331410 CAGAGGCTTTGGAGGCAGGAAGG - Intronic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1153966807 18:10189926-10189948 CAGTGGGCTTGGAGGCCTGATGG + Intergenic
1154346838 18:13549636-13549658 CAGTGGGTTCTGCTGGAAGAGGG + Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1154485930 18:14871223-14871245 CAGTAGGTTTAGAGGGAGGGTGG - Intergenic
1154518709 18:15202485-15202507 TAGTGTGTTTGAAGGGGAGAGGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1156737464 18:40277896-40277918 CAGAGGCTTTGGAGGGAGCATGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159128444 18:64252690-64252712 CAGCGGGCTTGGAGGGAGCATGG + Intergenic
1159913379 18:74167061-74167083 CAGGGGTTTTGGAGGCCAGAGGG - Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160175800 18:76593010-76593032 AAGTGGCTTTGCAGGGGAGACGG - Intergenic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164583141 19:29447564-29447586 CAGAGGGTTAGAAGGGGAGAGGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1165351267 19:35277281-35277303 TATTGGTTTTGGAGGAAAGAGGG + Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166633049 19:44424856-44424878 GAGTGGGTTGGTAGGGGAGATGG - Intronic
1167513594 19:49909954-49909976 CAGTCGGTTTGGAGGGTGGTGGG + Intronic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925851966 2:8090740-8090762 CAGCGGGTTTGGAGGGAGCCCGG - Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927517264 2:23679780-23679802 CAGAGGGTGTGGGAGGAAGAGGG + Intronic
927581155 2:24249352-24249374 CAGTCAGTTTGGGGGGAGGATGG - Intronic
927770118 2:25853319-25853341 CAGAGCCTTTGGAGGAAAGAGGG + Intronic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
928430948 2:31218046-31218068 AAGTAGGTTGGGAAGGAAGAGGG - Intronic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931239705 2:60441240-60441262 CAGTGAGTGTGCTGGGAAGACGG - Intergenic
931297171 2:60938606-60938628 CAGTGGGTTACGAGTGAAGCCGG + Intergenic
931376598 2:61713602-61713624 CCGTGGGTTTGGAGTGAATGAGG + Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
932495571 2:72144312-72144334 GAGTGTGTTTGGTGGGGAGAGGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932706778 2:74032159-74032181 CAGTGGGTTTTGAGGGATTGGGG + Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
934300367 2:91773038-91773060 CAGTGAGTTTTGAGGGTGGAGGG + Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935886712 2:107628456-107628478 CCATGGGTTTGGGGGGAAGTGGG - Intergenic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937347752 2:121137174-121137196 CAGAGGCTTGGGAGGGCAGAGGG - Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
940477102 2:154176988-154177010 CAGTAAGTTTGGAGTGGAGAGGG - Intronic
941054843 2:160776311-160776333 CAGAGGGTTTAGAGCCAAGATGG + Intergenic
941663505 2:168219536-168219558 CATTGGGTTTGGACAGTAGAGGG - Intronic
942181937 2:173388496-173388518 CAGAGGGTCTGGAAGGAAGCAGG + Intergenic
942245293 2:174002639-174002661 GCTAGGGTTTGGAGGGAAGAAGG + Intergenic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943176776 2:184486011-184486033 CACTGGCATTGGAGTGAAGAAGG + Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944463967 2:199982081-199982103 CAGTAGGTTTGGGGGGAACAGGG - Intronic
945935787 2:215901661-215901683 CCTTGGGTTAGGAGTGAAGAAGG + Intergenic
946033425 2:216723298-216723320 GAGTGGGGTTAGAGGGCAGAAGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946604810 2:221391995-221392017 CAGTGGTTTTGGAGCGCAAAGGG - Intergenic
946651283 2:221894524-221894546 CAGTAGATTGGGAGGGGAGAGGG - Intergenic
946816889 2:223588034-223588056 CAGTGGGTTTGGGGGCTGGAAGG - Intergenic
947368815 2:229424380-229424402 CAATGCGTTTGGAGGCAACATGG - Intronic
947500414 2:230667211-230667233 CAGTGCTTTTGGAGGGAGCATGG - Intergenic
947590127 2:231380686-231380708 AGGTGGGTTTTGAAGGAAGATGG - Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948163569 2:235844284-235844306 GAGTGGGTTTGGAGGGGGCAAGG + Intronic
948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG + Intergenic
948760477 2:240187238-240187260 AAGTGGGGTGGGAGGGAGGAAGG + Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168911011 20:1446719-1446741 CAGGTGGTTTGGAGGAGAGAAGG - Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1170096441 20:12650609-12650631 TAGTGGGTTTCCAGGGGAGATGG + Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170890529 20:20371490-20371512 CAGTCTGTTTGGGGGGAAAATGG + Intergenic
1172374811 20:34429911-34429933 TAGAGGAATTGGAGGGAAGAAGG + Intronic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1173012422 20:39194388-39194410 CAGAGAGTTAGGAGGGAGGAGGG - Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173193964 20:40898743-40898765 CACTGAGTTAGGAGGAAAGATGG + Intergenic
1173926536 20:46785238-46785260 CAGTGGGGTTGCAGCAAAGAGGG - Intergenic
1174105611 20:48160519-48160541 AAGGGGGTTTAGAGGGAACATGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174752167 20:53122567-53122589 CAAGGTGTTTGGAGGGAAGAGGG + Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1174926595 20:54766896-54766918 CAGTAGATTTGGAAGGAAGGAGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176795374 21:13368155-13368177 CAGTAGGTTTAGAGGGAGGGTGG + Intergenic
1178721601 21:35015438-35015460 TAATGGGTTTGGAAGGATGAAGG + Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179373405 21:40827966-40827988 CAGAGGAATTGGATGGAAGAAGG + Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180173103 21:46071041-46071063 CTGTGGATTTGGAAGCAAGAAGG + Intergenic
1180998562 22:19977421-19977443 CAGCTGCTTTGGAGGCAAGAAGG - Exonic
1181467402 22:23117595-23117617 CAGTGGGTGTGGCGTGGAGAGGG + Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183095257 22:35548104-35548126 CAGGGAGGTTGGGGGGAAGAAGG + Intronic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
949741485 3:7239350-7239372 CCGTGGGCTTTGAGGAAAGACGG + Intronic
950752826 3:15144366-15144388 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
950833720 3:15900036-15900058 CAGTGGCTGAGGTGGGAAGATGG - Intergenic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952743871 3:36760201-36760223 CACTGTGTTTGGAGAGATGATGG - Intergenic
953190679 3:40684406-40684428 CAGGAGGTTTGGAGGGCAAAGGG - Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
955017586 3:55087340-55087362 CAGTAGGTTTTGTGGGAAGATGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957058405 3:75461926-75461948 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
959430908 3:106253933-106253955 AAGTGTGTTTGGAGGGTAGCTGG - Intergenic
959459296 3:106604750-106604772 CAGTGGGTTTGGTTTCAAGATGG + Intergenic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
961285369 3:125798083-125798105 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
961295041 3:125877776-125877798 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
962361748 3:134748888-134748910 CAGTGGGTTCTGTGGGCAGATGG + Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
962958512 3:140288665-140288687 CAGTGGTGTTGGTGGGAAGCAGG - Intronic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964184192 3:153923171-153923193 CAGTGGGTTTTCAGGGTTGATGG + Intergenic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967011467 3:185438789-185438811 AAGTGGCTTTAGAGGAAAGAAGG + Intronic
967844747 3:194034773-194034795 GACTGGATTTGGAGGGAAGTAGG + Intergenic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
968937071 4:3617143-3617165 GAGAGGGATAGGAGGGAAGAAGG - Intergenic
969078060 4:4596344-4596366 CAGAGGGTTTGGAGGTAATCTGG - Intergenic
969515679 4:7646955-7646977 GAGGGGGTTTGGTGGGAACAGGG + Intronic
969741732 4:9033264-9033286 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
969801098 4:9566161-9566183 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
969969341 4:11029447-11029469 CAGAGGGTTTGGAAGGCAGCTGG + Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
972051711 4:34743260-34743282 CAGAGGCTTAGGAGGGAAAATGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
973168773 4:47112448-47112470 GAATGGCTTTGGAGGGAATAAGG + Intronic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
974149261 4:57984803-57984825 CAGTGGGTTTAGAGGGAGTAGGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979388410 4:120098129-120098151 CAGTCACTTTGGAGGGAAGTGGG + Intergenic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
983086560 4:163452401-163452423 AAGTGGGTTTGCAGGGATGCAGG + Intergenic
983566728 4:169160992-169161014 CAGAAGGCTTGGAGGGCAGAGGG - Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986535302 5:8780276-8780298 CAGAGGGTTAGGAGTGAAGGGGG + Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
988963694 5:36393925-36393947 CAGTGGTTTTCAAGAGAAGAGGG - Intergenic
989049015 5:37300403-37300425 CAGGAGGTTTGTAGGGAAGGTGG - Intronic
989124876 5:38042758-38042780 CAGTGTGTTTGTAGGGAAAACGG - Intergenic
989375212 5:40754053-40754075 CAGTGGTTTGGGTTGGAAGATGG - Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990097036 5:52129006-52129028 CCAAGGGTTTGCAGGGAAGAAGG + Intergenic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994022920 5:95048797-95048819 CAGGGGATTTGGAGAGAGGAAGG + Intronic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
996381101 5:122863374-122863396 CAGTGGGTTTGGAATGCAGTAGG + Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998531628 5:142890426-142890448 CAGTGGGTTAGGATGGGAGGAGG + Intronic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
999494434 5:152083267-152083289 GAGCTGGTTTGGTGGGAAGAAGG + Intergenic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002275952 5:178104600-178104622 CAGTAGGTTTAGAGGGAGGGTGG + Intergenic
1004189014 6:13447993-13448015 GGGTGGATTTGGAGGGAGGAGGG + Intronic
1004478289 6:15994679-15994701 CAGTGGGCTTGGGAGGGAGATGG + Intergenic
1004504827 6:16239062-16239084 CAGTTGGTTTAGAAGGAATAGGG + Intronic
1007345175 6:41223690-41223712 CAGGGGATTTGGAGGGCAGTGGG - Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1008332556 6:50261297-50261319 CAGTGAGTTTGGATTCAAGATGG - Intergenic
1009560828 6:65240427-65240449 GAGAGGGTTGGGAGGGAAGGAGG - Intronic
1010341028 6:74752740-74752762 CACTGGGTGTTAAGGGAAGAAGG - Intergenic
1010661625 6:78578079-78578101 CAAAGTCTTTGGAGGGAAGAGGG + Intergenic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1011716406 6:90109655-90109677 AAGCAGGTTTGGAGGGAGGATGG - Intronic
1011789165 6:90879416-90879438 CAGCTGGGTTGGAGGGGAGAAGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012442034 6:99269996-99270018 GAATGGGTTTGCAGGGAAAATGG - Intergenic
1013306931 6:108856740-108856762 CAATGGGTTATGAGGGAAGGTGG + Intronic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013968104 6:115980572-115980594 CAGTTGGTTTGGAAAGCAGAGGG - Intronic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1016468545 6:144350315-144350337 CAATGGTTTTGGAGAGAGGAAGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021558070 7:21941913-21941935 CCTTGGGTTTGGAGAGTAGAGGG - Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021866770 7:24965989-24966011 AAGGGGGTTTGGAGGAAACAAGG - Intronic
1022295851 7:29052127-29052149 CAGTGGACTTTGGGGGAAGATGG + Intronic
1022804389 7:33807346-33807368 CAGTAGGCTGGGAGGGATGAGGG - Intergenic
1023367159 7:39475425-39475447 GAGGGGCTTTTGAGGGAAGATGG + Intronic
1024720604 7:52133769-52133791 GAGTGGGTGTGGATTGAAGAAGG + Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1025996630 7:66531477-66531499 AAGTGGATTTGGTGGGTAGAGGG - Intergenic
1026988683 7:74570880-74570902 AAGTGGATTTGGTGGGTAGAGGG - Intronic
1027906794 7:84195514-84195536 CAGGGGGTTTGTTGGGAGGAGGG - Intronic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031969691 7:128055180-128055202 CAGGGGGTTGGGAGGCAGGAAGG + Intronic
1032066083 7:128772358-128772380 CAGTAGCTTTGTAGGCAAGAAGG + Intergenic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033718135 7:144024513-144024535 GAGTGGCTTGGGTGGGAAGAGGG - Intergenic
1033902845 7:146163765-146163787 AAGTGTGTTTGTAAGGAAGAGGG + Intronic
1034077760 7:148249230-148249252 CAGTGGGTTTGGTGGTGAGAAGG - Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035348637 7:158226925-158226947 CAGGCTGTTTGGAGGGAGGAGGG + Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035899050 8:3437706-3437728 TAGTGGCTTTGGTGGGAACAGGG - Intronic
1036209047 8:6827249-6827271 CAGTGGGTTTGCTGGGCAGCAGG - Intronic
1036246924 8:7125861-7125883 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036253879 8:7188549-7188571 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036363614 8:8098930-8098952 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036374966 8:8192138-8192160 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1036439250 8:8765758-8765780 CAGTGGGTTTCTGGGGGAGATGG + Intergenic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1036847401 8:12179142-12179164 CAGTGGCTTTGGGAGGAACAGGG + Intergenic
1036854577 8:12231013-12231035 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1036868769 8:12421463-12421485 CAGTGGCTTTGGGAGGAACAGGG + Intergenic
1036875936 8:12473506-12473528 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1036887341 8:12568139-12568161 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036894935 8:12626240-12626262 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038069087 8:23993373-23993395 CAGTGGGTTTGGAAGGCTGCAGG - Intergenic
1038539119 8:28376647-28376669 TAGTGGGTTTGGGGGAAAGTTGG - Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039806939 8:41008172-41008194 CAATGGGTTTGAAATGAAGAAGG + Intergenic
1040602479 8:48897911-48897933 CAGTGAGTTGGGAGGAAATATGG + Intergenic
1041467470 8:58171327-58171349 CAGTGGGTGTCCAGGGATGAAGG - Intronic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1042528028 8:69785212-69785234 AAGTGGTTTTGGAGGCAAAAAGG + Intronic
1043398192 8:79858493-79858515 CAGTGGATTTGGGGAGGAGAAGG - Intergenic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044554019 8:93542476-93542498 GAGTGAGTTTGAAGGGGAGAGGG + Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044824388 8:96182573-96182595 CCCTGGGTTTGGAGGGAGGGTGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045648651 8:104323351-104323373 CAGGGGAGTTGGAGGTAAGAAGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047201088 8:122768337-122768359 CAGTAGTTTTGAAGGGAACAGGG + Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049702854 8:144022982-144023004 AAGAGGGTTTTCAGGGAAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049703073 8:144023778-144023800 TAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049703307 8:144024588-144024610 GAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1051056803 9:12997073-12997095 CAGTGTATTTGTAGGTAAGAAGG - Intergenic
1051088286 9:13377513-13377535 CAGTTGGGTTGGGGGGAGGAAGG + Intergenic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052742212 9:32404189-32404211 GACTGCTTTTGGAGGGAAGATGG - Intronic
1052764611 9:32628484-32628506 GAATGGGATTGGAGGGGAGAGGG - Intergenic
1053886844 9:42650044-42650066 CAGTAGGTTTAGAGGGAGGGTGG - Intergenic
1054225863 9:62457494-62457516 CAGTAGGTTTAGAGGGAGGGTGG - Intergenic
1054454076 9:65420545-65420567 GAGAGGGATAGGAGGGAAGAAGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060270263 9:122135169-122135191 CAGGGGGTTTTGAGGCAAGGTGG - Intergenic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1062092011 9:134683276-134683298 CAGAAGGTTTGGAGGTGAGACGG - Intronic
1062093180 9:134689255-134689277 CAGAAGGTTTGGAGGTGAGATGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1185843174 X:3412334-3412356 AAGTGGGCTTGAAGGGAAAAAGG - Intergenic
1186102781 X:6174284-6174306 CAGTGAGTTTGCAGAGAAAAAGG + Intronic
1186961707 X:14743752-14743774 CAGAGACTTTGGAGGGAACATGG - Intergenic
1188786787 X:34356496-34356518 AAGTTGAGTTGGAGGGAAGAAGG - Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1191868830 X:65728236-65728258 CATTGAGTTTGGAGAGATGAAGG - Intronic
1192185626 X:68945003-68945025 CAGTGGCTGTGGAGTAAAGACGG + Intergenic
1192261357 X:69507328-69507350 CAGAGGGTTGGGAAGGAAAAGGG + Intronic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1194419788 X:93659667-93659689 CAGTAGGTTTTGATGGGAGAGGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196309651 X:114148609-114148631 CAGTGGGCTGTGAGGGATGAAGG + Intergenic
1196756225 X:119159746-119159768 CATTGTGTTTGGAGGGGACAGGG - Intergenic
1197569730 X:128134075-128134097 CCAAGGGTTTGGGGGGAAGAAGG + Intergenic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic