ID: 1059062685

View in Genome Browser
Species Human (GRCh38)
Location 9:111050055-111050077
Sequence AGGCAGCATCGCTGGAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059062678_1059062685 5 Left 1059062678 9:111050027-111050049 CCTGCAGTCCCAGCTACTCAGGA 0: 1562
1: 45781
2: 163407
3: 220027
4: 205967
Right 1059062685 9:111050055-111050077 AGGCAGCATCGCTGGAGCCCGGG No data
1059062680_1059062685 -3 Left 1059062680 9:111050035-111050057 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1059062685 9:111050055-111050077 AGGCAGCATCGCTGGAGCCCGGG No data
1059062676_1059062685 8 Left 1059062676 9:111050024-111050046 CCACCTGCAGTCCCAGCTACTCA 0: 15
1: 423
2: 1360
3: 2048
4: 2392
Right 1059062685 9:111050055-111050077 AGGCAGCATCGCTGGAGCCCGGG No data
1059062682_1059062685 -4 Left 1059062682 9:111050036-111050058 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1059062685 9:111050055-111050077 AGGCAGCATCGCTGGAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059062685 Original CRISPR AGGCAGCATCGCTGGAGCCC GGG Intergenic
No off target data available for this crispr