ID: 1059064800

View in Genome Browser
Species Human (GRCh38)
Location 9:111072036-111072058
Sequence CAGGCTCTCCTGAAGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059064800_1059064806 16 Left 1059064800 9:111072036-111072058 CCTCACAACTTCAGGAGAGCCTG No data
Right 1059064806 9:111072075-111072097 GGGAGAAAGCAAGGTTGTCATGG No data
1059064800_1059064804 -4 Left 1059064800 9:111072036-111072058 CCTCACAACTTCAGGAGAGCCTG No data
Right 1059064804 9:111072055-111072077 CCTGCTATGCACATATTAAGGGG No data
1059064800_1059064805 7 Left 1059064800 9:111072036-111072058 CCTCACAACTTCAGGAGAGCCTG No data
Right 1059064805 9:111072066-111072088 CATATTAAGGGGAGAAAGCAAGG No data
1059064800_1059064801 -6 Left 1059064800 9:111072036-111072058 CCTCACAACTTCAGGAGAGCCTG No data
Right 1059064801 9:111072053-111072075 AGCCTGCTATGCACATATTAAGG No data
1059064800_1059064802 -5 Left 1059064800 9:111072036-111072058 CCTCACAACTTCAGGAGAGCCTG No data
Right 1059064802 9:111072054-111072076 GCCTGCTATGCACATATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059064800 Original CRISPR CAGGCTCTCCTGAAGTTGTG AGG (reversed) Intergenic
No off target data available for this crispr