ID: 1059066931

View in Genome Browser
Species Human (GRCh38)
Location 9:111095288-111095310
Sequence ACTTTAGGAGAAGAGCAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059066927_1059066931 2 Left 1059066927 9:111095263-111095285 CCTGGTTATATCATTTGCTGGAA No data
Right 1059066931 9:111095288-111095310 ACTTTAGGAGAAGAGCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059066931 Original CRISPR ACTTTAGGAGAAGAGCAATG GGG Intergenic
No off target data available for this crispr