ID: 1059067681

View in Genome Browser
Species Human (GRCh38)
Location 9:111102708-111102730
Sequence ACCTGAGGCCTACATATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059067681_1059067685 11 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067685 9:111102742-111102764 AGAAGGCCATTCATCAAACAGGG No data
1059067681_1059067684 10 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067684 9:111102741-111102763 AAGAAGGCCATTCATCAAACAGG No data
1059067681_1059067683 -6 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067683 9:111102725-111102747 TCAGGTGATGCAGAAAAAGAAGG No data
1059067681_1059067692 28 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG No data
1059067681_1059067690 24 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067690 9:111102755-111102777 TCAAACAGGGGAGCAGACTGGGG No data
1059067681_1059067691 27 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067691 9:111102758-111102780 AACAGGGGAGCAGACTGGGGAGG No data
1059067681_1059067686 12 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067686 9:111102743-111102765 GAAGGCCATTCATCAAACAGGGG No data
1059067681_1059067689 23 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067689 9:111102754-111102776 ATCAAACAGGGGAGCAGACTGGG No data
1059067681_1059067688 22 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067688 9:111102753-111102775 CATCAAACAGGGGAGCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059067681 Original CRISPR ACCTGAGGCCTACATATGAA TGG (reversed) Intergenic
No off target data available for this crispr