ID: 1059067692

View in Genome Browser
Species Human (GRCh38)
Location 9:111102759-111102781
Sequence ACAGGGGAGCAGACTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059067681_1059067692 28 Left 1059067681 9:111102708-111102730 CCATTCATATGTAGGCCTCAGGT No data
Right 1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG No data
1059067682_1059067692 13 Left 1059067682 9:111102723-111102745 CCTCAGGTGATGCAGAAAAAGAA No data
Right 1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059067692 Original CRISPR ACAGGGGAGCAGACTGGGGA GGG Intergenic
No off target data available for this crispr