ID: 1059071508

View in Genome Browser
Species Human (GRCh38)
Location 9:111142191-111142213
Sequence GTTCCCACCATTTGCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059071508_1059071511 13 Left 1059071508 9:111142191-111142213 CCAGTTCTGCAAATGGTGGGAAC No data
Right 1059071511 9:111142227-111142249 AAGTTTCCAGACACCAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059071508 Original CRISPR GTTCCCACCATTTGCAGAAC TGG (reversed) Intergenic
No off target data available for this crispr