ID: 1059087974

View in Genome Browser
Species Human (GRCh38)
Location 9:111325008-111325030
Sequence AAGCCATATGTTCCATAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059087974_1059087976 24 Left 1059087974 9:111325008-111325030 CCATGTTATGGAACATATGGCTT No data
Right 1059087976 9:111325055-111325077 CTGCAAGGAGATACTCACCCAGG No data
1059087974_1059087975 9 Left 1059087974 9:111325008-111325030 CCATGTTATGGAACATATGGCTT No data
Right 1059087975 9:111325040-111325062 CTCTCTCAGCAAGATCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059087974 Original CRISPR AAGCCATATGTTCCATAACA TGG (reversed) Intergenic
No off target data available for this crispr