ID: 1059088196

View in Genome Browser
Species Human (GRCh38)
Location 9:111327687-111327709
Sequence CAAAATCACCACAGTCAAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059088196 Original CRISPR CAAAATCACCACAGTCAAAT GGG Exonic
905680528 1:39867833-39867855 CAAATATACCAGAGTCAAATGGG - Intronic
909412289 1:75368664-75368686 CACACACACCACACTCAAATTGG + Intronic
909689551 1:78391647-78391669 CAAATCCACCACAATCAAGTAGG - Intronic
910642340 1:89477084-89477106 CATATCCACCACAATCAAATAGG + Intergenic
910926760 1:92405526-92405548 CAAAATGACCACAGACACCTTGG - Intergenic
910951587 1:92653879-92653901 CAAACTCAGAACACTCAAATTGG - Intronic
911074902 1:93863742-93863764 AAAAATAAGCACAGGCAAATAGG + Intergenic
912857373 1:113181980-113182002 TTAATTCACCACAATCAAATAGG + Intergenic
915968972 1:160338971-160338993 CAAAATCACCAGAGACAAGATGG + Intronic
916021151 1:160793662-160793684 CAGAATCACCCCTGTCAACTGGG - Intergenic
917208534 1:172605187-172605209 CAAAAACACAATAGACAAATGGG - Intronic
917956602 1:180105706-180105728 AAGAATCACCACAATCAAATGGG - Intronic
919548552 1:198954839-198954861 CAAAATCACCATACAAAAATTGG + Intergenic
920731756 1:208493279-208493301 TTAATTCACCACAGTCAAGTCGG - Intergenic
920929658 1:210375367-210375389 GAAAATCACCAGGGTCAAAAAGG - Intronic
921289224 1:213639748-213639770 AAAAATCACCACAATTAAGTAGG - Intergenic
921505463 1:215963482-215963504 CAAAAGCAAAACAGACAAATTGG - Intronic
921757342 1:218874018-218874040 GAAATTCACCACAGTCTAAAGGG + Intergenic
923926935 1:238639943-238639965 CATAAACACCACAGTCTAGTTGG + Intergenic
1062762361 10:34623-34645 CAAAATCAACACACAAAAATCGG + Intergenic
1063008209 10:1994888-1994910 GAAAATCACCACGGCCTAATGGG - Intergenic
1068218632 10:54014553-54014575 CTAATCCACCACAGTCAAGTAGG + Intronic
1068825529 10:61434658-61434680 AAAAATCACCAAAGTCATATAGG - Intronic
1071456870 10:85857715-85857737 CAAAATCACCAGATAAAAATAGG + Intronic
1073572649 10:104593547-104593569 CACAATCACCACAGTTACTTTGG + Intergenic
1073602972 10:104864775-104864797 CCAAATCACCAAAGGCAAACTGG + Intronic
1074520177 10:114213413-114213435 CAAAATAATCACAGTGAAAGTGG + Exonic
1076981231 11:205951-205973 CAAAGTCACCAGGCTCAAATCGG - Exonic
1076983757 11:220587-220609 CAAAATCACACAAATCAAATTGG - Intronic
1078644314 11:13125733-13125755 CAAAATCAGCACTGTAAGATGGG - Intergenic
1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG + Intergenic
1080308654 11:30864530-30864552 CAAAATTACAACAGTACAATGGG - Intronic
1082108514 11:48245804-48245826 CAAGATAACCACAGCGAAATGGG - Exonic
1082612575 11:55319279-55319301 CAAGATAACCACGGTAAAATGGG - Intergenic
1082680284 11:56159568-56159590 CACAACCACCACTGTCAAATGGG + Exonic
1082957012 11:58880689-58880711 CAAAAACAGCAGAGTCAAACAGG + Intronic
1083228111 11:61297252-61297274 CTAAACCACCAATGTCAAATAGG + Intergenic
1083312342 11:61790528-61790550 CAAAAGCACCACGGTCAGATGGG + Exonic
1085293405 11:75416393-75416415 CAAATTCACCATTGTAAAATGGG - Intronic
1085817286 11:79752734-79752756 CAAAATAAACATAGACAAATGGG + Intergenic
1086839789 11:91670875-91670897 CGAATTCACCACAATCAAGTCGG + Intergenic
1087151354 11:94862369-94862391 CTAAATGGCCACAGTCAAATTGG + Intronic
1087817069 11:102670890-102670912 CTAATTCACCACAATCAAGTAGG - Intergenic
1092121687 12:6048756-6048778 CAAAATCATTACAGTCAGCTGGG - Intronic
1093477224 12:19569492-19569514 CTAATCCACCACAGTCAAGTAGG - Intronic
1095186102 12:39201599-39201621 CCAATCCACCACAATCAAATGGG + Intergenic
1095259125 12:40078486-40078508 CTAATCCACCACAATCAAATAGG - Intronic
1095823997 12:46512444-46512466 CTAATTCACCACAATCAAGTAGG - Intergenic
1095836216 12:46641812-46641834 CTAATTCACCACAATCAAGTAGG + Intergenic
1097916766 12:65029224-65029246 TTAATTCACCACAATCAAATAGG - Intergenic
1099353767 12:81608143-81608165 CTAATTCACCACAATCAAGTGGG - Intronic
1099755555 12:86843597-86843619 CACAATCAACACAGTAAAAAAGG + Intergenic
1099860935 12:88225221-88225243 CAAAAGCAATACAGACAAATGGG - Intergenic
1100094321 12:91013211-91013233 CAAAATCAACACATAAAAATCGG - Intergenic
1100466523 12:94850329-94850351 CAAAATCAACACACAAAAATCGG + Intergenic
1100577926 12:95909693-95909715 CTAATTCACCACAATCAAGTGGG + Intronic
1101600373 12:106204479-106204501 CACAATCACCACAGCATAATAGG - Intergenic
1105353549 13:19637438-19637460 TAAAAACACCACTTTCAAATGGG - Intronic
1108988677 13:56628399-56628421 CTAATACACCACAGTCAAGTAGG + Intergenic
1110261527 13:73490649-73490671 CAAAATCACCAAAGGAGAATGGG + Intergenic
1110376848 13:74803498-74803520 CAAAAAAACCACAGTTATATTGG + Intergenic
1111060656 13:83014652-83014674 CAAAATTGCCACAGTAAAACAGG - Intergenic
1111077240 13:83253049-83253071 CTAATTCACCACAATCAAGTAGG + Intergenic
1111482798 13:88853848-88853870 CAAAATCAACAAATACAAATCGG + Intergenic
1111713954 13:91853982-91854004 AAAAATAACCATAGTGAAATTGG - Intronic
1111946264 13:94668872-94668894 TAAAAACAACACAGTCATATTGG - Intergenic
1112223102 13:97511441-97511463 TTAATTCACCACAGTCAAATAGG - Intergenic
1112680721 13:101761977-101761999 CAAAATCAGCAGAATCAAAAAGG - Intronic
1114036314 14:18632033-18632055 CAACCTCACAACAATCAAATGGG - Intergenic
1114122322 14:19683001-19683023 CAACCTCACAACAATCAAATGGG + Intergenic
1117515845 14:56500384-56500406 CAAAACCACCAAAACCAAATGGG - Intronic
1118524960 14:66629679-66629701 CAGCATCACCACAGTCATGTAGG + Intronic
1119148470 14:72337175-72337197 CAGAAGCACCACAGTCTCATGGG - Intronic
1120093816 14:80365190-80365212 TATAAGCACAACAGTCAAATGGG + Intronic
1120131622 14:80814729-80814751 CAAAAACAAAACAGACAAATGGG + Intronic
1121590154 14:95099794-95099816 CAAAAGCAACACAGATAAATGGG - Exonic
1122332589 14:100933328-100933350 CAAAATCAACACAATCACATTGG - Intergenic
1123798315 15:23796112-23796134 CAAAAACAACACAATAAAATTGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125510606 15:40290587-40290609 CAAAGTCACCACAGACAAGATGG - Exonic
1126192456 15:45892169-45892191 CAAAATAAGCACAGAAAAATAGG - Intergenic
1126192465 15:45892260-45892282 CAAAATAAGCACAGAAAAATAGG - Intergenic
1129751965 15:78071829-78071851 CAAAAACACCACAGACTAAGTGG + Intronic
1130248387 15:82275568-82275590 TTAATTCACCACAGTCAAGTGGG + Intronic
1130451962 15:84064241-84064263 TTAATTCACCACAGTCAAGTGGG - Intergenic
1134462902 16:14445329-14445351 AAAACTCCCCACAGTCAGATCGG + Intronic
1135914395 16:26592091-26592113 AAAAATCTCCACAGTGAATTTGG - Intergenic
1138793327 16:59935706-59935728 CAAAAGCACCACAGTGACAGTGG - Intergenic
1144490653 17:15705257-15705279 CAAAATCAGGACATTCACATTGG + Intronic
1145768584 17:27476492-27476514 CAACGGCACCACAGTCAAACAGG - Intronic
1146235182 17:31153379-31153401 CAAAAGCATCACTGTCTAATAGG - Intronic
1146883457 17:36456213-36456235 CACAGTCACCACAGACAAACTGG - Intergenic
1147669939 17:42171129-42171151 CATCCTCACCACAGCCAAATGGG - Intronic
1150244608 17:63665005-63665027 CAAAATCTCCACAGGCAGCTGGG + Intronic
1152955271 18:34953-34975 CAAAATCAACACACAAAAATCGG + Intergenic
1154392892 18:13957057-13957079 CTAATCCACCACAGTCAAGTAGG + Intergenic
1155349275 18:24890726-24890748 CAAGATCACCCAACTCAAATGGG - Intergenic
1155614651 18:27707421-27707443 TTAATTCACCACAGTCAAGTAGG - Intergenic
1156433750 18:37103633-37103655 CAAAATAAAAACAGGCAAATGGG + Intronic
1157238662 18:45988482-45988504 AAAAATAACCTCATTCAAATAGG + Intronic
1158096345 18:53776238-53776260 CAAAATCATCATAGAAAAATCGG - Intergenic
1158297706 18:56016944-56016966 CAGCATCACCACGGTCAATTGGG + Intergenic
1165007276 19:32817531-32817553 CACACTCACCACAGTCAAGAGGG - Intronic
925253746 2:2464671-2464693 CAAAATGACCACATTCAAAATGG - Intergenic
925301802 2:2821068-2821090 CAAAATCAACACACAAAAATCGG + Intergenic
925560667 2:5190663-5190685 AAAAATACCCAGAGTCAAATGGG - Intergenic
926973973 2:18494972-18494994 CTGGATCACCACATTCAAATGGG + Intergenic
928060493 2:28107763-28107785 CAAAATCTTCACAGTCTAGTGGG - Intronic
932806500 2:74788709-74788731 TTAATTCACCACAATCAAATAGG - Intergenic
933324045 2:80813604-80813626 CCAAATCATCACAGTCACAGAGG + Intergenic
933431945 2:82193286-82193308 AAAACTTACCACAGTCACATGGG + Intergenic
934142166 2:89057046-89057068 TTAAATCACCACAGTCTTATTGG - Intergenic
934220462 2:90077558-90077580 TTAAATCACCACAGTCTTATTGG + Intergenic
934227073 2:90143500-90143522 TTAAATCACCACAGTCTTATTGG + Intergenic
935195998 2:100817056-100817078 CAAAGTTCTCACAGTCAAATTGG - Intergenic
936789412 2:116133409-116133431 TAAAATAACCACAGAGAAATTGG - Intergenic
937033170 2:118758087-118758109 AGACATCACCACAGTCAAAAAGG - Intergenic
937278252 2:120700153-120700175 CAAAAGCAGCACAGGCAAGTGGG - Intergenic
937728132 2:125191470-125191492 CTAATCCACCACAATCAAATAGG - Intergenic
937938342 2:127264592-127264614 TTAATTCACCACAATCAAATAGG - Intronic
938142371 2:128806440-128806462 AAAAATTACCACAGACAAACAGG - Intergenic
938441292 2:131336139-131336161 CAACCTCACAACAATCAAATGGG - Intronic
938567014 2:132527941-132527963 CAAAAGCAAAACAGACAAATGGG - Intronic
939449777 2:142358532-142358554 AAAAATCACCACAGACATAATGG - Intergenic
941048890 2:160708853-160708875 GAAATTCACCACAATCAAGTAGG - Intergenic
943190378 2:184670523-184670545 TAAGAACATCACAGTCAAATAGG - Intronic
943911180 2:193569989-193570011 CTAATTCACCACAATCAAGTAGG - Intergenic
944148814 2:196535687-196535709 CCAAATCATCACAGTCACCTTGG + Intronic
945227522 2:207547266-207547288 CAAAATCACTACATCCAAATGGG - Intronic
947467285 2:230362409-230362431 CAACATCCCCACATTTAAATGGG - Intronic
948083094 2:235223306-235223328 CAACATAAGCACAGTCTAATTGG + Intergenic
948416880 2:237813823-237813845 AAAAATCACCTGAGTCAATTTGG - Intronic
948530148 2:238599004-238599026 CAAAATCAGAATAGTCAAAGAGG - Intergenic
1169999581 20:11599890-11599912 CAAAATCAGCACATAAAAATTGG + Intergenic
1172216388 20:33238602-33238624 CAAAATGACCACAGTGTAGTGGG - Intronic
1172443894 20:34983333-34983355 AAAAATCAAGACAATCAAATGGG - Intronic
1177548803 21:22594568-22594590 CAAAATGGACACAGGCAAATAGG - Intergenic
1177611946 21:23461409-23461431 CAAAATTACCAGAGGCAAAGAGG - Intergenic
1180460441 22:15559093-15559115 CAACCTCACAACAATCAAATGGG - Intergenic
1181574333 22:23784089-23784111 CAAAAAGTTCACAGTCAAATGGG + Exonic
1182591604 22:31385182-31385204 CAAATCCACCACGATCAAATAGG - Intergenic
1182647464 22:31822002-31822024 CAAAATCACAAAAGTCAGAGAGG - Intronic
949797891 3:7870667-7870689 CAAAATTACCACAGAGAATTAGG - Intergenic
950323357 3:12079651-12079673 CTTATTCACCACAATCAAATTGG - Intronic
955296811 3:57743134-57743156 CAAAATACTCACAGTCTAATAGG + Intergenic
955905105 3:63798991-63799013 AAAACACACCACAGTCCAATAGG - Intergenic
956397757 3:68843866-68843888 CTAATTCACCACAATCAAGTTGG - Intronic
957446362 3:80316645-80316667 CAAATTCACCACAATCAAATTGG + Intergenic
957756045 3:84489070-84489092 CAAAATCAACAAAGATAAATTGG - Intergenic
958608310 3:96389453-96389475 CTAAACCACCACAATCAAGTAGG - Intergenic
959205044 3:103297177-103297199 TAACATCACCCCAATCAAATCGG - Intergenic
959291338 3:104478271-104478293 CTAATTCACCACAATCAAGTAGG + Intergenic
959527748 3:107396883-107396905 AAAAACCACCTCAGGCAAATTGG + Intergenic
960699392 3:120425868-120425890 CAAAATCAGGACACTCAATTGGG - Intronic
961938737 3:130614358-130614380 CTAATTCACCACAATCAAGTAGG - Intronic
962534620 3:136316670-136316692 CAAAAATTCCACACTCAAATAGG + Intronic
962637305 3:137344375-137344397 CAATATCTCCACACTCTAATGGG + Intergenic
963417412 3:145015757-145015779 TTAATTCACCACAATCAAATAGG + Intergenic
963925732 3:150949000-150949022 CTAAACCACCACAATCAAGTAGG + Intronic
964437264 3:156667238-156667260 CAAAATCACCATATTGAATTTGG + Intergenic
964720104 3:159762618-159762640 CACAATCACCACAGAGAAAAGGG + Intronic
965113351 3:164455535-164455557 TTAAATCACCACAGGTAAATCGG - Intergenic
966080933 3:175999285-175999307 CTAATTCACCACAATCAAGTTGG + Intergenic
966784872 3:183614323-183614345 CAAAACCACCACAGCAGAATGGG - Intergenic
967786585 3:193503421-193503443 GACAATAACCACTGTCAAATAGG - Intronic
968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG + Intronic
970188765 4:13490197-13490219 CAAATTCACCACAATAACATTGG + Intergenic
970771947 4:19624147-19624169 CAAAATAATCACTATCAAATTGG - Intergenic
972468140 4:39377831-39377853 CAAAGTCAAAACAGACAAATGGG - Intergenic
973112908 4:46417040-46417062 CACTATTACCACAGTCAAAGTGG - Intronic
973211550 4:47620901-47620923 CAAAATAATAACAGGCAAATAGG + Intronic
975477226 4:74837189-74837211 CAAAATGAGCACAGGCATATCGG + Intergenic
976068918 4:81219470-81219492 CAAAAGCATCAAAGGCAAATGGG - Intergenic
976115194 4:81718987-81719009 CTTATTCACCACAATCAAATCGG + Intronic
976565742 4:86548757-86548779 CAAAATCACCAGGGTCAGAGTGG - Intronic
976640392 4:87331601-87331623 CTAATCCACCACAGTCAAGTAGG - Intergenic
976857233 4:89619172-89619194 CAAAATCATCACACTGAAAAGGG + Intergenic
977656462 4:99527075-99527097 AAAATTCAACACAGTAAAATTGG - Intronic
978044020 4:104104802-104104824 AAAAATCACCATGATCAAATGGG + Intergenic
978163587 4:105579580-105579602 CTAATTCACCACAATCAAGTAGG - Intronic
979565406 4:122149267-122149289 CAAAATCACATCACTCAAAATGG + Intergenic
979865770 4:125751252-125751274 TAAAATGACCACAGATAAATAGG - Intergenic
979920771 4:126493160-126493182 AAAAATCACCAAAAGCAAATAGG + Intergenic
980300166 4:130980894-130980916 CAAAAGCACCACAATAAAATAGG - Intergenic
980428146 4:132654136-132654158 CAAAATCAACACACAAAAATCGG - Intergenic
980580922 4:134749156-134749178 CTAATTCACCACAATCAATTAGG + Intergenic
981209726 4:142088832-142088854 CAAAATTTCCACAGTCTAGTAGG + Intronic
981601630 4:146495517-146495539 CAAGATCATCACAGTCCAAATGG - Intronic
982413585 4:155106774-155106796 CACAATCACCACACTGAAACAGG + Intergenic
983303811 4:165960605-165960627 TTAATTCACCACAATCAAATAGG + Intronic
983899314 4:173116641-173116663 CTTATTCACCACAATCAAATAGG + Intergenic
984236240 4:177162079-177162101 CTAATTCACCACAATCAAGTAGG + Intergenic
984924288 4:184793223-184793245 CAAACCCACTACAGTGAAATCGG + Intronic
985006326 4:185538171-185538193 CAAAATCAGCACGGCCAAAATGG - Intergenic
985443614 4:190005134-190005156 CTAATTCACCACAGTGAAGTAGG + Intergenic
986085801 5:4444516-4444538 CAAAATCTCCACAGCCACGTGGG - Intergenic
986751769 5:10794062-10794084 CAAAATGATCACAGGCAAAGTGG + Intergenic
986909581 5:12537943-12537965 CTAATCCATCACAGTCAAATAGG + Intergenic
988052364 5:26047442-26047464 CAAAATCAAAAAAGACAAATTGG + Intergenic
989324041 5:40169474-40169496 TTAATTCACCACAGTCAAGTAGG + Intergenic
989555944 5:42794745-42794767 CAAAAACACCAAAGACAAAAGGG + Intronic
989768960 5:45119655-45119677 CTTATCCACCACAGTCAAATTGG + Intergenic
990044981 5:51418053-51418075 AGAAATCACCACAGTTAAAATGG + Intergenic
991158187 5:63462997-63463019 CTAATCCACCACAGTCAAGTAGG + Intergenic
991694522 5:69257875-69257897 CAAAATCTCCAGAGTTAGATGGG - Intronic
992206841 5:74439049-74439071 CAAAATCAGGACAGTCACAGGGG - Intergenic
993263874 5:85696381-85696403 CTAATCCACCACAATCAAATAGG + Intergenic
993460875 5:88179459-88179481 CAGAAGCATCACAGTCATATAGG + Intergenic
993664874 5:90683707-90683729 CAATATCTCCACAGTGATATTGG - Exonic
993913088 5:93708177-93708199 CAAAGTCACAAGAGTCATATTGG + Intronic
993928407 5:93902239-93902261 CATAATTACTACAGTAAAATAGG + Intronic
994480190 5:100324442-100324464 AAATAGCAACACAGTCAAATAGG - Intergenic
995388079 5:111610278-111610300 TTAATTCACCACAGTCACATAGG - Intergenic
996617887 5:125463269-125463291 CAAAATCACCATATTAAAAATGG + Intergenic
998790105 5:145757279-145757301 TAAAAGCACCTCAGTCATATAGG + Intronic
999225732 5:150022567-150022589 AAAAATCACCACAGAAAGATTGG - Intronic
1001973946 5:175981470-175981492 CAAAATCAACAGAGTGAAATAGG + Intronic
1002243486 5:177862309-177862331 CAAAATCAACAGAGTGAAATAGG - Intergenic
1003727048 6:8776706-8776728 CAAAATAAGCACAGTTACATGGG - Intergenic
1005146531 6:22697386-22697408 CAAACTCATTACAATCAAATGGG + Intergenic
1005203718 6:23377019-23377041 CAAAATCAATACAGAAAAATTGG - Intergenic
1005501040 6:26429463-26429485 CAAAATTGCCACTGTCAACTTGG + Intergenic
1005505619 6:26466766-26466788 CAAAATTGCCACTGTCAACTTGG + Intronic
1008316019 6:50042215-50042237 CAAAATCACAAGATGCAAATAGG + Intergenic
1008485933 6:52035728-52035750 CAAAAACAGCATATTCAAATGGG + Intronic
1009412728 6:63384878-63384900 CAAAATGACATCAGTCAGATTGG - Intergenic
1009547224 6:65035004-65035026 CTAATCCACCACAGTCAAGTAGG + Intronic
1010161462 6:72861687-72861709 CAAAATTACAACAGACAATTTGG - Intronic
1012668766 6:102013779-102013801 CAAATCCACCACAATCAAGTAGG - Intronic
1013031783 6:106340891-106340913 AAAAACTACCACAGTCAACTGGG + Intergenic
1013858063 6:114598987-114599009 CAAAATTACTACAGAAAAATAGG - Intergenic
1014567055 6:122962138-122962160 CTAATTCACCACAATCAAGTAGG + Intergenic
1015483668 6:133744014-133744036 AAAAATCACCACAATCATAAAGG + Intergenic
1015906754 6:138125078-138125100 CTAATCCACCACAATCAAATAGG + Intergenic
1016675215 6:146757264-146757286 AAAAACCACCACAATCAACTAGG - Intronic
1017544395 6:155435414-155435436 TAAAAGAACCACAGTCTAATGGG + Intronic
1020397242 7:7730102-7730124 AAAAATCACAACTGTCATATGGG + Intronic
1020780433 7:12510599-12510621 CAAAACCACCACAGTTAGAATGG - Intergenic
1021074839 7:16289472-16289494 ATAAAACACCACAGTCAAGTGGG + Intronic
1023036647 7:36136977-36136999 CAAATTCTGCACAGTGAAATGGG + Intergenic
1024106418 7:46092198-46092220 CAAATCCACCACAATCAAACAGG - Intergenic
1026698498 7:72618184-72618206 CACACACACCACAGACAAATTGG + Intronic
1026821296 7:73551241-73551263 CAAAAGCACCACAGACAATAAGG + Intronic
1027430451 7:78106869-78106891 CAAAATAAATACAGACAAATGGG - Intronic
1027907592 7:84206263-84206285 AAAATTCACCAGAGTAAAATTGG - Intronic
1028172997 7:87621519-87621541 CAAAAACACTACAGAAAAATTGG + Intronic
1030431556 7:109455323-109455345 CACCATCACCACAGGCCAATGGG + Intergenic
1030718749 7:112843920-112843942 CCAATCCACCACAGTCAAGTAGG + Intronic
1031310292 7:120188043-120188065 TAAAATCACTACAGTTAAATAGG - Intergenic
1031669205 7:124522014-124522036 CAAATCCACCACAGTCGAGTAGG - Intergenic
1032646511 7:133830721-133830743 CAAATGCACCACAGTAATATAGG - Intronic
1033392998 7:140946234-140946256 AAAAATCACCAGAGACAGATGGG - Intergenic
1034301568 7:150020125-150020147 TTAAATCACCTTAGTCAAATAGG + Intergenic
1034788030 7:153943053-153943075 CAAAATCAGAACGGTCAAAAAGG - Intronic
1034804478 7:154077143-154077165 TTAAATCACCTTAGTCAAATAGG - Intronic
1035251328 7:157599334-157599356 CAGAGTCAACACAGACAAATGGG - Intronic
1037261702 8:17016765-17016787 CAAACTCTTCACAGGCAAATAGG + Intergenic
1038207190 8:25477777-25477799 CAAACTGAACATAGTCAAATAGG + Intronic
1038519981 8:28223189-28223211 CTAATTCACCACAATCAAGTAGG - Intergenic
1041606878 8:59792511-59792533 CAAATTAGCCACAGTAAAATAGG + Intergenic
1042703894 8:71646522-71646544 TTAATTCACCACAATCAAATAGG - Intergenic
1045091570 8:98750894-98750916 CTAACTCACCACAGTCAAGTAGG + Intronic
1046011570 8:108554865-108554887 CACAGTCTCCACACTCAAATAGG + Intergenic
1046126571 8:109916819-109916841 CAAAATCAATACAGTAAAAAGGG - Intergenic
1046977943 8:120303585-120303607 CTAATCCACCACAGTCAAGTAGG - Intronic
1047138196 8:122105767-122105789 CTAAAAAAACACAGTCAAATAGG - Intergenic
1051748028 9:20314143-20314165 CAAAAACACAACAGGAAAATGGG + Intergenic
1052247936 9:26361023-26361045 AAAAAACACCACAGTAAAGTGGG - Intergenic
1052618964 9:30880466-30880488 CTAATTCACCACAATCAAGTAGG - Intergenic
1052686183 9:31759764-31759786 CAAAATCAACATATACAAATTGG - Intergenic
1053076675 9:35139727-35139749 CAAAGACACCACAGCCAAAGAGG + Intergenic
1057366063 9:94422277-94422299 CAAAATCAGCAAAGGCAAAAGGG - Intronic
1057657269 9:96965788-96965810 CAAAATCAGCAAAGGCAAAAGGG + Intronic
1058199726 9:102024587-102024609 CATATTCACCACAATCAAGTAGG - Intergenic
1058386971 9:104447684-104447706 CAAAGTCACCAAAGGCAAAGTGG + Intergenic
1058398916 9:104590742-104590764 CACAATCACCACTGTCATGTGGG - Intergenic
1058534490 9:105943289-105943311 CAAAATAAGCATATTCAAATAGG + Intergenic
1059008980 9:110435909-110435931 CAAAATCATCACAGTGAGTTTGG + Intronic
1059088196 9:111327687-111327709 CAAAATCACCACAGTCAAATGGG + Exonic
1059694239 9:116715702-116715724 CAAAGATCCCACAGTCAAATGGG - Intronic
1060331565 9:122675857-122675879 CAGAATCACCACAGTGAGATGGG - Exonic
1060507203 9:124206962-124206984 CAAAATCACCAAATACACATCGG - Intergenic
1060852149 9:126886858-126886880 CAGAGTCACCAGAGTCAAACTGG - Intergenic
1187605814 X:20881678-20881700 CAAAATCAACACACAAAAATGGG + Intergenic
1187801811 X:23072082-23072104 CTAATTCACCACGATCAAATAGG + Intergenic
1188293607 X:28418277-28418299 CAAAATCTGCACAATCAAAAAGG + Intergenic
1188426243 X:30050333-30050355 GAAAAGCAAAACAGTCAAATTGG + Intergenic
1189221735 X:39377951-39377973 AAAAACCACCATAGGCAAATTGG + Intergenic
1189575380 X:42346658-42346680 GAAAATAACCACAGACAAAAAGG - Intergenic
1189878238 X:45459763-45459785 TTAATTCACCACAGTCAAGTAGG - Intergenic
1192953383 X:76041621-76041643 CTAATTCACCACAATCAAGTAGG - Intergenic
1193277681 X:79608687-79608709 CTAATTCACCACAATCAAGTAGG + Intergenic
1193529699 X:82642049-82642071 CACAATCACCACAGTCCCACTGG + Intergenic
1193584018 X:83298571-83298593 CTAAACCACCACAATCAAGTAGG + Intergenic
1193701378 X:84765893-84765915 CTAATCCACCACAGTCAAGTAGG - Intergenic
1194460168 X:94156834-94156856 CAAAATCAACATAGAAAAATTGG - Intergenic
1195524385 X:105869703-105869725 TAAAATCTACACAGTCAAAATGG - Intronic
1195815974 X:108888352-108888374 CAAAATCAACACACACAAATTGG + Intergenic
1199322668 X:146459244-146459266 TTAATTCACCACAGTCAAGTAGG + Intergenic
1200021542 X:153214835-153214857 CAAAGTCACCACCCTAAAATGGG + Intergenic
1201467488 Y:14299379-14299401 CAAAATCAACACACAAAAATTGG + Intergenic
1202070943 Y:20990886-20990908 CAAAAGCACTACAGAGAAATTGG + Intergenic