ID: 1059092449

View in Genome Browser
Species Human (GRCh38)
Location 9:111374346-111374368
Sequence CAGGCACACCTGAAGATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059092449 Original CRISPR CAGGCACACCTGAAGATATT TGG (reversed) Intronic
900566734 1:3336066-3336088 CAGGCACAGCTGTGGAGATTGGG - Intronic
901615907 1:10539540-10539562 CAGCCACACATCAAGATAATTGG + Intronic
901656634 1:10773318-10773340 CCGGCACACCTGAAGATCCGAGG - Intronic
903375396 1:22862717-22862739 GAGGCACATCTGAAGATGTCTGG - Intronic
903565931 1:24265972-24265994 AAGGCACACTTGTAGATATTTGG - Intergenic
905774574 1:40660350-40660372 CAGTCACACCTGCAGATTGTTGG + Intronic
907600938 1:55768621-55768643 CAGGCACCCCAGATAATATTTGG - Intergenic
917623707 1:176824624-176824646 CAGGCAAACATGAGGACATTGGG - Intronic
919216218 1:194559476-194559498 CAGGCACACATGCATATATATGG - Intergenic
920561333 1:206940879-206940901 CAGGCACACCGTAAGATCTCAGG + Intronic
920880172 1:209872417-209872439 CAGACACCCCTGAGCATATTTGG - Intergenic
922109576 1:222543896-222543918 CAGGCAGCCCTGAGGATCTTGGG + Exonic
1065318303 10:24485613-24485635 CAGGCACAGCTCAAGATGCTGGG - Intronic
1065623330 10:27606071-27606093 CAGGGTCACCCGAAGTTATTCGG - Intergenic
1065738233 10:28773103-28773125 CAGACACACATGAACATAATGGG - Intergenic
1066516727 10:36170307-36170329 CAGGCAGAGCTGAAGATAGATGG - Intergenic
1067782616 10:49219867-49219889 CAGGCACACCTTAAAAAACTGGG + Intergenic
1069861037 10:71471984-71472006 CAGGCACACCTGTAGATGTGGGG - Intronic
1071701378 10:87940923-87940945 AATGCAAACCTGAAGCTATTAGG - Intronic
1076607476 10:131698457-131698479 CAGGCACACCTGAAGAAGGGTGG - Intergenic
1079115166 11:17635863-17635885 CAGGCCCACCTGAAGAAGCTGGG + Intronic
1079603464 11:22339723-22339745 CCGCCAAACCTGAAGAGATTTGG - Intronic
1079685599 11:23355323-23355345 CAGGCACACCTGAATAATCTAGG + Intergenic
1080033918 11:27691319-27691341 AAGGAGCACCTGAAGATATATGG + Intronic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1092857417 12:12687632-12687654 CAGGAATAACTGAAAATATTGGG + Intronic
1097109059 12:56644629-56644651 CAGTTTCACCTGAAGAAATTAGG - Intronic
1099081603 12:78190423-78190445 CAGGTACTCCCTAAGATATTGGG + Intronic
1102111672 12:110370053-110370075 CAGGCACACCTCAAGATTCATGG + Intergenic
1104771651 12:131367726-131367748 CAGGCCCACCTGCAGACATCAGG + Intergenic
1108395118 13:49984341-49984363 CAGGCAAACCTGAACATGTATGG + Intergenic
1110335450 13:74324741-74324763 CAGGAACACATGAAAATATTAGG + Intergenic
1110565525 13:76953999-76954021 CAGGAAAAACAGAAGATATTAGG - Intronic
1116001496 14:39247216-39247238 CAGACACAGCTGAAGATGGTGGG - Exonic
1116222833 14:42111120-42111142 CAGGCATAACTGCAGATATTTGG - Intergenic
1117843006 14:59880655-59880677 CAGGAACCCCAGGAGATATTTGG + Intergenic
1119099465 14:71866785-71866807 CAGGCAGACATGAAAACATTAGG + Intergenic
1125133232 15:36309524-36309546 AAGGCACACTTAAAGATAGTAGG - Intergenic
1126188021 15:45849441-45849463 CAGGAACAACTGAAGCAATTTGG + Intergenic
1130329802 15:82913110-82913132 CAAGCAAACCTGCAGATAGTGGG + Intronic
1131729503 15:95264859-95264881 CAGGCACACTTGAATGAATTAGG - Intergenic
1132662419 16:1067527-1067549 CAGACACACCTGAAGGTGGTTGG + Intergenic
1134338296 16:13321668-13321690 CAGGCACACCTGAACACACAAGG - Intergenic
1140628164 16:76819949-76819971 GAGGCACAGATGCAGATATTAGG + Intergenic
1144483355 17:15645403-15645425 CAGGCAAACCTGAGGTTTTTGGG - Intronic
1144915333 17:18719623-18719645 CAGGCAAACCTGAGGTTTTTGGG + Intronic
1145294273 17:21575531-21575553 CAGGCCCCCCTGGAGATACTGGG + Intergenic
1145369554 17:22297655-22297677 CAGGCCCCCCTGGAGATACTGGG - Intergenic
1149364469 17:55928384-55928406 CAGGCACTGTTGTAGATATTGGG + Intergenic
1149611116 17:57958212-57958234 CAGGCAGAGCTGAAGAAATGAGG - Intergenic
1154046868 18:10914394-10914416 CATGAACACCTGCAGATTTTGGG - Intronic
1157232465 18:45931199-45931221 AAGGCACACTTGAAGCTACTTGG + Intronic
1164702950 19:30298684-30298706 CTGGCATACCTGCAGATATGGGG - Intronic
1166446832 19:42865429-42865451 CAGGTCCACCTGCAGTTATTTGG - Intronic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
928461280 2:31475312-31475334 AATGAAGACCTGAAGATATTAGG + Intergenic
931598563 2:63977933-63977955 CAGGGAAACCTGAAGATAGTAGG - Intronic
932894494 2:75626004-75626026 AGGGTAAACCTGAAGATATTGGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936911197 2:117595867-117595889 CAACCAAACCTGAAGATAATTGG - Intergenic
939442151 2:142263200-142263222 CAGTCACACCGTAAGGTATTAGG + Intergenic
942629512 2:177940362-177940384 AAGGCAGCCCTGATGATATTTGG + Intronic
942687184 2:178545656-178545678 CCGGCATACCTGAAGAAGTTGGG - Exonic
945321987 2:208435320-208435342 CAGGCACAACAGCAGGTATTAGG - Intronic
946452270 2:219790745-219790767 CAGGGACACCTGAAGAGACTAGG + Intergenic
1170533559 20:17317908-17317930 CAGGCAACCCTCAAGCTATTTGG - Intronic
1173815484 20:45985033-45985055 CAGGCACCACAGAGGATATTCGG + Intergenic
1175858093 20:62133522-62133544 CAGGCACACCTGGAGAGCTTAGG + Intronic
1178069606 21:28948995-28949017 CAGTCACACCTGTGCATATTTGG - Intronic
953039718 3:39244996-39245018 CAGGACCACCTTAAGTTATTAGG + Intergenic
954437949 3:50505812-50505834 CAGCCACACGTTAAGATCTTGGG + Intergenic
956426391 3:69140052-69140074 CAGGCACAGAAGAAAATATTCGG - Intergenic
957746408 3:84348589-84348611 CAGGCACACCTTAAAATGTCTGG + Intergenic
964064538 3:152562592-152562614 CAGCCACAGCTGCAGATATTAGG + Intergenic
965685691 3:171299764-171299786 CAGGCCCTATTGAAGATATTTGG + Intronic
967125224 3:186417296-186417318 CAGGCACAGTAGAAGATCTTGGG - Intergenic
967555459 3:190851576-190851598 CAGGCTCAGCTGAGGATATAAGG - Intergenic
969882238 4:10184559-10184581 CAGGCACTGCTGAAGGTCTTAGG - Intergenic
971614113 4:28764883-28764905 TAGGCACACCTCTAGGTATTTGG + Intergenic
973204896 4:47549470-47549492 CAGGCACCCCTGAAGGTAAGAGG - Intronic
973659749 4:53091721-53091743 CAGGCAGACATGAAGATTTCTGG + Intronic
977775037 4:100907655-100907677 CAGCCACACTTCCAGATATTGGG + Intergenic
977827229 4:101547698-101547720 TAGGCATACCTGTATATATTTGG + Intronic
982542313 4:156689268-156689290 CAGACACCACTGAAGACATTTGG + Intergenic
984152246 4:176148568-176148590 CAGACACACCTGCAGACAGTGGG - Intronic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
985218151 4:187674830-187674852 CAGACACACCTGCAGGTTTTGGG + Intergenic
988345949 5:30037696-30037718 TAGTCACACCTAAAGATATCTGG + Intergenic
989553886 5:42768822-42768844 AAGGCACACCTGCATATATCTGG - Intronic
992102585 5:73421543-73421565 GAGCCACAACTGAAGAGATTTGG + Intergenic
996095371 5:119392854-119392876 CAGGCACAAAAGAAGATCTTGGG + Exonic
997374362 5:133386532-133386554 CAGGAAGACCTGAAGAAATGGGG - Intronic
998791737 5:145773011-145773033 CAGTTACACCTAAAGATTTTGGG - Intronic
999241516 5:150130554-150130576 CAGGCAGACCAGATGATGTTCGG + Exonic
999738523 5:154531287-154531309 GAGGCACACCTGAAGATCACTGG - Intergenic
1000052871 5:157577052-157577074 GAGGCACTCCTGAAGATGATGGG + Intergenic
1003699196 6:8443655-8443677 CAGACACACATGAAGAGTTTAGG + Intergenic
1003783621 6:9457907-9457929 CAGGTACACATGAAGCTATGTGG - Intergenic
1011899944 6:92280455-92280477 CAATCACAACAGAAGATATTAGG - Intergenic
1012270909 6:97209161-97209183 AATGAACACTTGAAGATATTTGG - Intronic
1013314438 6:108927777-108927799 CAGGGCCAGCTGAAGATCTTAGG + Intronic
1014539628 6:122658889-122658911 CAGGCACTCCTCTAGATACTGGG + Intronic
1015918975 6:138247864-138247886 CAGGAACACCTGAAGTTAACAGG + Intronic
1016842877 6:148542116-148542138 CAGGTACACCTGAATTCATTTGG - Intronic
1018031049 6:159842094-159842116 CAGGCACATCGTAAGATAATGGG - Intergenic
1022052614 7:26692568-26692590 AAGGGACACCTGAAAATATCTGG + Intronic
1023051134 7:36252237-36252259 CAGTCAGACCTGAAGGTTTTGGG + Intronic
1027361284 7:77413215-77413237 CAAGGTCACCTGAGGATATTGGG - Intronic
1031791082 7:126105461-126105483 CATGCACACATGAAAATAATGGG - Intergenic
1032760417 7:134935488-134935510 CAGGCACACGAGAAGATGTTGGG + Intronic
1035396141 7:158536378-158536400 CAGGCACACATGAAGACACAAGG + Intronic
1045635995 8:104190587-104190609 CAGGCAAACTTGAATATATTTGG - Intronic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1048731339 8:137444198-137444220 CATGCCCACGTGATGATATTAGG + Intergenic
1048971482 8:139647360-139647382 CAGGCACAGCTGTAGACATGTGG + Intronic
1052532642 9:29707640-29707662 AAGGCAAAGCTGTAGATATTTGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055163580 9:73162815-73162837 CAGACACATCTGGAGATTTTCGG + Exonic
1059092449 9:111374346-111374368 CAGGCACACCTGAAGATATTTGG - Intronic
1059276287 9:113099953-113099975 CAGGCAAATAGGAAGATATTGGG + Intergenic
1186166805 X:6835153-6835175 CAGCCAGAACTGAAGAAATTGGG + Intergenic
1188285318 X:28319835-28319857 CTAGCAAACCTGAATATATTTGG - Intergenic
1189429148 X:40931883-40931905 CAGGCACAGCTGCAGATACATGG + Intergenic
1193036411 X:76956356-76956378 CATACAAACCAGAAGATATTGGG - Intergenic
1193268904 X:79506705-79506727 CATGCACACCTGAAGCTGTTGGG - Intergenic
1195003771 X:100667190-100667212 CTGGAACACCTCAAGATGTTAGG + Intronic