ID: 1059093264

View in Genome Browser
Species Human (GRCh38)
Location 9:111384482-111384504
Sequence CATTGGGAATGGAGTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059093264 Original CRISPR CATTGGGAATGGAGTGGAGC AGG (reversed) Intronic
901078344 1:6569606-6569628 TATGGTGAATGGAGTGGGGCAGG + Intronic
901459033 1:9380598-9380620 CATTGGCAGTGGATGGGAGCAGG + Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
904372157 1:30056121-30056143 CAGTGGGAATGGAATGGACGTGG - Intergenic
904392883 1:30197372-30197394 CAGTGGGTAAGGGGTGGAGCAGG - Intergenic
904618368 1:31761781-31761803 GATTAGGAGTGGAGTGGAGAGGG + Intronic
904823790 1:33261789-33261811 AAGTGGGAAGGGAGAGGAGCAGG + Intronic
905272916 1:36798506-36798528 CAGTGGGCATGGAGCTGAGCTGG - Exonic
905346674 1:37315789-37315811 CATGGGATATGGAGTGGAGGAGG - Intergenic
905357613 1:37395657-37395679 CATTGGGAAAGGGCTGGAGCTGG - Intergenic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906822156 1:48940966-48940988 AATTGGGAAAGGAGGGGAGTGGG + Intronic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907401955 1:54229744-54229766 GAGTGGGAAGGGAGTGGAGGTGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907804762 1:57807125-57807147 CATGGAGAATGGACTGGAGAAGG - Intronic
908360932 1:63367791-63367813 CCCTGGGAGTGGAGCGGAGCTGG - Intronic
909405928 1:75289490-75289512 CATTGGGAATGGAGTACTTCTGG - Intronic
912801994 1:112725527-112725549 CAGTGGGAATGGGGTGGGGGTGG - Intronic
915541051 1:156566467-156566489 CCTTCGGAATGGAGTGCTGCTGG - Exonic
915578464 1:156797517-156797539 CATTGAGACTGAAGTAGAGCAGG - Intronic
920264915 1:204714662-204714684 CATTGGGAAGGGAGTTGGGGAGG + Intergenic
920388803 1:205586144-205586166 ATATGGGAATGGAGAGGAGCCGG - Exonic
920525617 1:206663892-206663914 CACTGGGCACGGAGGGGAGCCGG + Intronic
920900321 1:210103800-210103822 TATTGGGAATGGAGTTAGGCAGG + Intronic
924190908 1:241551876-241551898 CATTAGGACTGGGGTGGAGGCGG + Intronic
1063692986 10:8304729-8304751 GATAGGGAATGAAGTGGAGCAGG + Intergenic
1065641553 10:27787451-27787473 TTATGGGAATGGAGTGGGGCGGG + Intergenic
1066225456 10:33378522-33378544 TATTGGGAATTGAGTAGAGGTGG - Intergenic
1067061929 10:43082082-43082104 CTTGGGGAATGGAGGGGAGCGGG - Intronic
1068799009 10:61118274-61118296 GATTGTGAATGGAGTAGAGGTGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069688050 10:70331737-70331759 CGTTGGGAGTGGAATGGAGTGGG - Intronic
1070467102 10:76734483-76734505 CATTGGCAATGAATTGAAGCTGG - Intergenic
1070760088 10:79018693-79018715 CAAGGGGAATGGGGTGGGGCGGG + Intergenic
1071860087 10:89663454-89663476 CATAGAGAATGGACTGGGGCAGG + Intergenic
1072064917 10:91858560-91858582 CCTTGGGAGTGGAGTAGAGTGGG - Intronic
1072891447 10:99329034-99329056 CAATGGGGAAGCAGTGGAGCCGG + Intergenic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073142396 10:101256996-101257018 CAGTCAGAATGGAGTGGACCAGG - Intergenic
1073498427 10:103915281-103915303 CTTTGGGAAGGGAGTGGGGCTGG - Intronic
1074144074 10:110701194-110701216 CACTGGGAACGGAGTTGAGAAGG - Intronic
1075445199 10:122508191-122508213 ACTTGGGGATGGAGTGGAGATGG + Intronic
1076263411 10:129090243-129090265 CATTGGGACTGGAGTGAGGGTGG + Intergenic
1076899720 10:133332190-133332212 CATTGGAAATGGAGAGGTGTGGG + Intronic
1077613279 11:3658377-3658399 CATTGGGTCTGGATTGGAGCAGG - Intronic
1078372972 11:10766167-10766189 CATTGGGAGTGGAGTGGCAGAGG + Intronic
1078598501 11:12710537-12710559 CAGTGAGAATAGAGTGGTGCTGG + Intronic
1078893636 11:15579271-15579293 CATTAGGATTGGAGTGGGGTTGG - Intergenic
1081144267 11:39542245-39542267 CACTGGGAAGGGGGTGGGGCAGG + Intergenic
1081416029 11:42817383-42817405 CATAGGGAATGGGGTGAAGGTGG - Intergenic
1082893461 11:58164568-58164590 CATTGGGATGGGTGTGGACCAGG - Intronic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1084495664 11:69501665-69501687 CATTGGTAATGGGGCGGAGTGGG + Intergenic
1085043444 11:73340215-73340237 TCTTGGCAATGGAGTGGGGCTGG - Intronic
1087480509 11:98693967-98693989 CATTGAGACTTGAGAGGAGCCGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088979046 11:114844831-114844853 TATGGAGAATGGAGTGGAGGAGG + Intergenic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1089583502 11:119495906-119495928 CGTTGGGAGAAGAGTGGAGCAGG - Intergenic
1089662685 11:119995914-119995936 CATGGGGGATGGAGTGGAGGGGG - Intergenic
1089670221 11:120051665-120051687 CATTGTGTATCGACTGGAGCTGG - Intergenic
1089750994 11:120651055-120651077 CTTTGGGAATGGGGTTGATCTGG + Intronic
1089872900 11:121692639-121692661 CATGGGGAAAGGAGTGAAGCAGG - Intergenic
1090278417 11:125435636-125435658 CATCAGGAATGAATTGGAGCAGG - Intergenic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1091297893 11:134486607-134486629 CAGCGGTAATGGAGCGGAGCAGG - Intergenic
1093414003 12:18899433-18899455 GATTGGGAATGGGGTGGGGAGGG - Intergenic
1094527112 12:31238748-31238770 CATTAGCAATGGTGTTGAGCAGG - Intergenic
1096648248 12:53049669-53049691 CGCTGGGGAGGGAGTGGAGCTGG - Intronic
1097200322 12:57272800-57272822 AATGGGGAAGGGAGTGCAGCAGG - Intronic
1099262482 12:80400597-80400619 CCTTGGGAAGGGAGAGGAGTGGG - Intergenic
1101667318 12:106831120-106831142 ACATGGTAATGGAGTGGAGCAGG - Intronic
1101855235 12:108436752-108436774 AATTGGGAATGGAGTCTAACTGG + Intergenic
1103510355 12:121469283-121469305 CTTTGGGAATGGAGTGATGTGGG - Intronic
1103736269 12:123062871-123062893 CATTGGTAGTGGGGTGAAGCAGG - Intronic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1103837552 12:123835234-123835256 CATTTGGAGTGGAGGGGAGCTGG + Intronic
1104576596 12:129972250-129972272 AATTGGTAATGGTGTGGAGGAGG - Intergenic
1104732302 12:131114522-131114544 CATTCCAAATGGATTGGAGCTGG + Intronic
1105056135 12:133100868-133100890 CATTCGGGGTGGGGTGGAGCAGG + Intronic
1106476818 13:30105957-30105979 CAATGGGAATGTATTCGAGCTGG + Intergenic
1107338916 13:39385397-39385419 CAGTGGGAATGGAAAAGAGCTGG + Intronic
1107409768 13:40147866-40147888 CATTGGGCATGGAGTGGGCGAGG - Intergenic
1107987144 13:45785381-45785403 CTTTGGGAATGAACTGAAGCAGG - Intronic
1108077454 13:46696143-46696165 CATTGGGTAAGAAGTGGAGTGGG - Intronic
1108331228 13:49386776-49386798 GTCTGGGAATGGAGTGGGGCTGG - Intronic
1109580473 13:64325544-64325566 ATTTTGGAATGGAGTGGAGTGGG + Intergenic
1110370745 13:74737579-74737601 CATTGAGAAGGGAAGGGAGCAGG + Intergenic
1111166584 13:84465129-84465151 CATGGAGGATGGAGTGAAGCAGG + Intergenic
1112094433 13:96116531-96116553 GTTTGGGAATGGAGTGGGGATGG - Intronic
1112841271 13:103581397-103581419 CATGGGGAATGAAATGGAGAAGG + Intergenic
1114701112 14:24679608-24679630 AAGGGGGAATGGGGTGGAGCAGG - Intergenic
1115807328 14:37065579-37065601 TGTTGGGAATGGAATGGAGTAGG - Intronic
1115908806 14:38232328-38232350 CACTGAAAATGGAGTGGAGGCGG + Intergenic
1116988452 14:51246533-51246555 CATTGGGAATGGGAAGGAGGAGG + Intronic
1119298602 14:73552919-73552941 CATGGGGGATGGAAGGGAGCTGG - Intronic
1119302896 14:73585095-73585117 CATGGGGGATGGAAGGGAGCTGG - Intergenic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121573099 14:94962197-94962219 CTTTGAGGAGGGAGTGGAGCTGG + Intergenic
1121780798 14:96620937-96620959 GAATGGGCATGGAGTGAAGCCGG - Intergenic
1121811663 14:96896557-96896579 CATGGGGAATGTGGTGGAGAAGG + Intronic
1122030544 14:98908404-98908426 CATTTGGCATGGGGTGAAGCAGG + Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122421714 14:101582046-101582068 CCTTGGGCTTGGTGTGGAGCAGG - Intergenic
1122956232 14:105072818-105072840 CAATGAGAATGGTGTGCAGCTGG + Intergenic
1125541003 15:40470295-40470317 CATTTGGAAGGGTGAGGAGCTGG - Intergenic
1126822901 15:52522363-52522385 GATTGGGAGTGGGGTGGTGCTGG + Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1127774828 15:62256454-62256476 CCTGGGGAATAGAGTGGAGGGGG - Intergenic
1127775421 15:62260680-62260702 CCTGGGGAATAGAGTGGAGGGGG - Intergenic
1129676866 15:77636490-77636512 CATTGGGCATGGAGCAGGGCTGG + Intronic
1131035226 15:89217732-89217754 CAGAGAGAAAGGAGTGGAGCTGG + Intronic
1132576420 16:666434-666456 CACTGGGAATGGAGTGGGTGAGG - Exonic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133099484 16:3470506-3470528 CTTTGGGAAGGACGTGGAGCTGG - Intronic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133741090 16:8652067-8652089 CCGTGGAAGTGGAGTGGAGCTGG - Intergenic
1134602040 16:15541221-15541243 CATTGGGCAAGGTGTGGAGAGGG + Intronic
1135085696 16:19472976-19472998 CATTTGGCTGGGAGTGGAGCCGG - Intronic
1135181809 16:20281400-20281422 CATTTGGGATGGAGTGGGGAGGG + Intergenic
1135509542 16:23070288-23070310 CATGTGGAATTGAGTGGTGCGGG - Intronic
1136579276 16:31142257-31142279 AACTGGGAATGGGGCGGAGCCGG - Intronic
1137284726 16:47005924-47005946 TATTGGAAGTGGGGTGGAGCAGG - Intergenic
1137364369 16:47848097-47848119 CCTATGGAATGGAGTGGAGGTGG + Intergenic
1138684319 16:58711387-58711409 CCATGGGAATGGAGTGGAAAGGG - Intronic
1138911210 16:61401407-61401429 TATTGAGAATGGGGTGGAGTGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1141137712 16:81477506-81477528 CAGTGGGAAAGGAGGGGACCTGG - Intronic
1141971817 16:87489665-87489687 CCTTGGGACTGGGGTGTAGCGGG + Intronic
1142186042 16:88695176-88695198 CCTGGGGAAGGGAGAGGAGCCGG - Intergenic
1144625173 17:16840783-16840805 CATGGGGAAGGGACTGAAGCAGG + Intergenic
1144868526 17:18353288-18353310 TATTGGGAATGGTGTGGAAGTGG - Intronic
1145707797 17:26938309-26938331 GAATGGGAGTGGAGTGGAGTGGG + Intergenic
1146582947 17:34055918-34055940 CATTGGGAATAGAGTAGAGGGGG + Intronic
1146667121 17:34712619-34712641 CTTAGGAAGTGGAGTGGAGCAGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147133020 17:38419905-38419927 GACTGGGAAAGGAGGGGAGCCGG - Intergenic
1147542799 17:41374987-41375009 CAATGGGAATAGAGTTGAGCTGG + Intronic
1147579328 17:41619482-41619504 CATGGGGAAGGGACTGAAGCAGG + Exonic
1148105731 17:45117948-45117970 CATTGGGAAGGCTGTGGGGCTGG + Intronic
1148693257 17:49545035-49545057 CATTGGGTATGGGTTGGGGCTGG + Intergenic
1149432138 17:56602928-56602950 CGTGGAGAATGGATTGGAGCTGG - Intergenic
1149611139 17:57958302-57958324 CAGGGGGAATAGAGTGGGGCAGG + Intergenic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150601023 17:66651089-66651111 CATCGGAAGTGCAGTGGAGCCGG + Intronic
1151354876 17:73552441-73552463 CATTGAAACTGGAGTGGCGCAGG + Intronic
1151815108 17:76467974-76467996 CCTGGGGAATGGGGAGGAGCAGG - Intronic
1152347239 17:79760652-79760674 CCCTGGGAATAGAGTGGGGCCGG - Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1153006891 18:504983-505005 CATGGGGGATGCAGTGGAGATGG - Intergenic
1154310172 18:13261158-13261180 CATTGGGAACGGTGAGGTGCTGG + Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155749871 18:29408599-29408621 GGTTGGGAGTGGAGTGGAGGTGG - Intergenic
1156006780 18:32451588-32451610 TTGTGGGAATGTAGTGGAGCAGG - Intronic
1157849628 18:51035884-51035906 GAATGGGAATGGAGTGGAGGAGG + Intronic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1162583177 19:11542868-11542890 CATTAAGATTGCAGTGGAGCCGG - Intronic
1162794193 19:13078248-13078270 CATTGGGAAAGGAGTGCAGGAGG - Intronic
1164684526 19:30158127-30158149 CATGGGGAATGGGGGGCAGCAGG + Intergenic
1165335314 19:35165811-35165833 CACTGGGAAGGGAGTGAAGGAGG + Intronic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1165436132 19:35796608-35796630 CATTGGGAATGAAATGCAGTGGG - Intergenic
1165751548 19:38263698-38263720 AAAGGGGAATGGAGTGGGGCAGG - Intronic
1166763358 19:45238342-45238364 CAGTGGTAATGGGTTGGAGCTGG + Intronic
1167498790 19:49834252-49834274 CATTGGGAATGCAGGGGAGGAGG + Intronic
1168018827 19:53594464-53594486 CATTGGGACTGGAATGGAGGTGG + Intergenic
1168031445 19:53683033-53683055 CTTTGGGAATGGAGTGGGGCGGG + Intergenic
1168038298 19:53737938-53737960 CTTTGGGAATGGAGTCGGGCGGG + Intergenic
1168041965 19:53765894-53765916 CTTTCGGAATGGAGTGGGGTGGG + Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926105800 2:10150015-10150037 CATTGGAAATGGAGTGTAGCTGG + Intronic
927918666 2:26953811-26953833 ATTTGAGATTGGAGTGGAGCTGG - Intergenic
928251884 2:29688221-29688243 CAATGGGAAGAGAGTGGACCAGG + Intronic
928449778 2:31367919-31367941 CAGTGGGAATGGGGTGGCCCTGG - Intronic
928648895 2:33384380-33384402 CATGGGGAATGCAGTGGGTCGGG + Intronic
932460066 2:71876268-71876290 CAGTGGGAATAGAATGGTGCTGG + Intergenic
932683763 2:73850304-73850326 CTGTCGGGATGGAGTGGAGCAGG + Intronic
932722175 2:74146400-74146422 GACTGGGAATGGAGTGTGGCAGG + Intronic
933016413 2:77132898-77132920 CATTGGGAGGGAAGTGGAGGAGG + Intronic
933194452 2:79372410-79372432 CCTTGGGAATGGAGAAGACCTGG - Intronic
933751475 2:85604708-85604730 CAGTGGGAATGCAGTTGGGCAGG - Intronic
935775015 2:106465796-106465818 TATGAGGAGTGGAGTGGAGCTGG + Intronic
935905053 2:107830100-107830122 TATGAGGAGTGGAGTGGAGCTGG - Intronic
936072218 2:109378732-109378754 CATGGGGCATGGAGTAGAGAAGG - Intronic
936126832 2:109795183-109795205 TATGAGGAGTGGAGTGGAGCTGG - Intronic
936217865 2:110576303-110576325 TATGAGGAGTGGAGTGGAGCTGG + Intronic
936258579 2:110937502-110937524 GATTGGGAGTGGAGAGGAGAAGG - Intronic
936427206 2:112432401-112432423 TATGAGGAGTGGAGTGGAGCTGG + Intronic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
938783295 2:134604306-134604328 CATAGAGAATGGAATAGAGCAGG + Intronic
939285320 2:140121835-140121857 CACTGGGAAGGGGATGGAGCGGG - Intergenic
939677275 2:145088151-145088173 CATAGGGAAGGGAGAGGTGCCGG + Intergenic
943446594 2:187994656-187994678 CATGTGGAATGGAGGGTAGCAGG - Intergenic
943743617 2:191438064-191438086 CAATGGGAATGGAATGGGGGTGG - Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945310460 2:208306633-208306655 CATTCGGAGTGGAATGGAACAGG + Intronic
946010858 2:216562488-216562510 CATTGGAATTGGAATGGGGCTGG + Intronic
946207973 2:218124516-218124538 CACTGGGAAAGGAGTGAAGCTGG - Intergenic
946497128 2:220205885-220205907 CATTTGGAATGGAGTGGTGGTGG + Intergenic
948315682 2:237026812-237026834 CATTGGGAATGGAGACCAGGTGG + Intergenic
948339777 2:237240270-237240292 GGTTGGGAATGGAGTGGGGCAGG - Intergenic
1170204848 20:13786763-13786785 AATTGGGATGGGATTGGAGCAGG + Intronic
1170783669 20:19449233-19449255 CCCTGGGAATGCAGGGGAGCTGG - Intronic
1170906058 20:20516064-20516086 CAATGGGAGTGGAGAGTAGCAGG - Intronic
1170944555 20:20879517-20879539 CTTTGGGAGGTGAGTGGAGCAGG + Intergenic
1171015042 20:21532887-21532909 CACTGGGAATGGACAAGAGCAGG + Intergenic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1177884607 21:26733020-26733042 CATGGGGAGTGAAGTGTAGCAGG + Intergenic
1178702553 21:34845686-34845708 GACTGGGAAGGGAGTGGGGCGGG - Intronic
1179233044 21:39522760-39522782 CACTGGGACAGGAGTGAAGCTGG - Intergenic
1179595024 21:42437642-42437664 GAGTGGGAAGGGAGTGGAGGTGG + Intronic
1179615929 21:42583560-42583582 CCTTGGGAATGGAGGTGACCTGG - Intergenic
1179994141 21:44966223-44966245 CAGCGGGATTGGAGAGGAGCTGG + Intronic
1181671253 22:24426553-24426575 GATGGGGAAGGGAATGGAGCTGG + Intronic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1184268491 22:43363779-43363801 TAGTTGGGATGGAGTGGAGCGGG - Intergenic
1184880219 22:47299889-47299911 CACTGGGACTGCAGGGGAGCTGG - Intergenic
1185133931 22:49057923-49057945 CACTTGGAATGGACTGAAGCTGG + Intergenic
950935306 3:16833503-16833525 AATTGAGAATGGAGTTGAGTGGG - Intronic
951115360 3:18854971-18854993 CACTGGGGATGGGGTGGAGGTGG - Intergenic
953918239 3:46934391-46934413 CTTTTGAAAGGGAGTGGAGCTGG - Intronic
954387034 3:50249475-50249497 CAATGGGGAGGGAGTGGTGCTGG + Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
955018294 3:55092855-55092877 GATTGGGAGTGGAGAGGAGGAGG - Intergenic
955408675 3:58642111-58642133 CATTGAGGCTGGAGTGGAACAGG + Intronic
958720706 3:97839461-97839483 CATTAAGTAGGGAGTGGAGCTGG - Intronic
961094380 3:124142061-124142083 AATTGAGAATGGAGGGGAGAGGG - Intronic
961321974 3:126082927-126082949 CAGTGGGAATGTTCTGGAGCCGG + Intronic
961329092 3:126128497-126128519 CAGTGGGAATGTTCTGGAGCCGG - Intronic
962875952 3:139536194-139536216 ACTTGTGAATGGAGGGGAGCTGG - Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
965449978 3:168825754-168825776 CATTGTCAATGGAGTAGAGAAGG - Intergenic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
968912575 4:3483629-3483651 CATTACGGAAGGAGTGGAGCCGG - Intronic
969282108 4:6177743-6177765 CATTGGGGGTGGAGTGGAGGAGG - Intronic
969348212 4:6582219-6582241 CAGTGGGAAGGGAGTGGGGTTGG - Intronic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
970195875 4:13549308-13549330 CAAGGGGAAGGGACTGGAGCAGG + Intergenic
971066248 4:23036092-23036114 CATTTGCTCTGGAGTGGAGCAGG - Intergenic
971473488 4:27051094-27051116 GATTGCTAATGGGGTGGAGCTGG - Intergenic
973832435 4:54775170-54775192 GATTGGGGGTGAAGTGGAGCAGG + Intergenic
974227081 4:59060347-59060369 CAAGGGGAATGGGGTGGTGCTGG + Intergenic
974856223 4:67465115-67465137 CATAGGGAATGGGGAGTAGCAGG - Intergenic
978641780 4:110879213-110879235 CATGAGGAATGTAGTGGAGCAGG + Intergenic
979417143 4:120456383-120456405 CATTAGGAAACCAGTGGAGCAGG + Intergenic
981555791 4:145992012-145992034 AATTGGGAGTGGAGTGGGGAAGG - Intergenic
982637290 4:157913049-157913071 CACTGGGCATGGGGTGGAGGGGG + Intergenic
983076325 4:163331710-163331732 GATTGGGAATGGACAGGAGGTGG - Intronic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
984747052 4:183231653-183231675 CATAGGGAATGAAGGAGAGCAGG + Intronic
985395486 4:189538955-189538977 CATTGGCAATGCTGTGGGGCAGG - Intergenic
986415203 5:7521053-7521075 CAATGGCAGTGGAGTGGGGCTGG - Intronic
987231456 5:15897864-15897886 CAATGGGAATGGACTAGAGTTGG + Intronic
987264264 5:16235807-16235829 ACTGGGGAATGGTGTGGAGCAGG - Intergenic
988885166 5:35548774-35548796 CATCTGGAATGGAGTGGATGTGG + Intergenic
988905557 5:35784821-35784843 CATGGAGAATGGATTGGAGCAGG + Intronic
990299280 5:54434469-54434491 CTTCAGGAAAGGAGTGGAGCTGG - Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991631249 5:68658272-68658294 GATTGGGACTGGGATGGAGCTGG + Intergenic
991979395 5:72215715-72215737 CATTGGGAATGCACTGGGGAAGG + Intergenic
993935816 5:94000909-94000931 CAATGGCAATACAGTGGAGCAGG - Intronic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
996853407 5:127977882-127977904 CATTGGGAAAGAAGTGAAGTGGG - Intergenic
997033394 5:130158184-130158206 CACTGGGAATGCAGTTCAGCAGG + Intronic
997799309 5:136843858-136843880 CATTGGGAATGGAGTTCAAGAGG + Intergenic
998031524 5:138873805-138873827 CATGTGGGATGGAGTGGACCTGG - Exonic
998453174 5:142250376-142250398 CATTTAGAAGGGAGTGCAGCAGG - Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1005283873 6:24303390-24303412 TTTTGGGAATGGAGGGGAGCAGG - Intronic
1007144601 6:39615716-39615738 CTTTGGGCATGAAGTGGAACAGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1011873599 6:91927296-91927318 CAGTGGTACGGGAGTGGAGCAGG - Intergenic
1012366348 6:98445457-98445479 TATGTGGAATGGAGTGGGGCAGG - Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013289665 6:108709133-108709155 CCCTGGGAATGGTGGGGAGCAGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013776556 6:113684864-113684886 CAATGGGAATGCAGTGGAACTGG + Intergenic
1014592565 6:123292079-123292101 CGAAGGGAATGGAGTTGAGCAGG - Intronic
1015143359 6:129959198-129959220 CCTTGGCTATGGAGAGGAGCGGG + Intergenic
1015587924 6:134795154-134795176 CCCTGGGAATGGAGTGGGGGAGG + Intergenic
1015910524 6:138164159-138164181 CAGTGGAAATGGACTGGAGTGGG - Intronic
1016684650 6:146867424-146867446 CACTGGGCATTGAGTGGAGTAGG - Intergenic
1017277844 6:152590717-152590739 CATAAGCAATGGAGTGGAGGTGG - Intronic
1017415944 6:154220694-154220716 CATTAGGAATGGTGTAGGGCAGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018715710 6:166530948-166530970 CATTGGGAAAGCAGAGCAGCAGG - Intronic
1019677133 7:2320681-2320703 CATCCAGACTGGAGTGGAGCAGG - Intronic
1020032998 7:4945951-4945973 CTTTGGGAAAGGAGTTGGGCTGG - Intronic
1020356305 7:7279450-7279472 TGGTGGGAATGGAGTGGAGGAGG + Intergenic
1020390417 7:7651701-7651723 CTTTGGGAATTGAGTGAACCAGG - Intronic
1021268761 7:18558952-18558974 CATTGGGAAGTGAGGGGAACAGG + Intronic
1021418583 7:20419144-20419166 CATTTGTAATGGAGAGGAGAAGG + Intergenic
1023080430 7:36521423-36521445 TAATGGGATGGGAGTGGAGCCGG + Intronic
1026149689 7:67777269-67777291 CCTTGGGAATGCTGGGGAGCAGG + Intergenic
1026432047 7:70357267-70357289 CCTTGGGAAGGCAGAGGAGCTGG - Intronic
1027230492 7:76269071-76269093 CATTGGGGAGGGGGTGGAGGTGG - Intronic
1029839588 7:103347835-103347857 CCTTGGCACTGGAGAGGAGCTGG + Intronic
1031457752 7:122004355-122004377 AATGGGGAAGGGAGTGGAGTGGG + Intronic
1031567586 7:123319968-123319990 AATGGGGAATGAAGGGGAGCTGG + Intergenic
1031680522 7:124667900-124667922 CTTTGGGAGGGGAGAGGAGCAGG - Intergenic
1033712341 7:143960750-143960772 CAGAGGGACTGGAGTGGGGCTGG - Exonic
1033967359 7:146992603-146992625 CAGGGAGAATGGGGTGGAGCCGG - Intronic
1034186317 7:149179769-149179791 TATGGGGAAGGGAGTGGAGGGGG + Exonic
1037477113 8:19268803-19268825 CATTGAGAATGGAGTGGCTTAGG + Intergenic
1038731504 8:30132152-30132174 CATTGGCAAAGGAGTGAATCAGG + Exonic
1038875223 8:31541103-31541125 CAAACTGAATGGAGTGGAGCAGG + Intergenic
1039440921 8:37594955-37594977 CATTGGGAGGGGCGTGGAGACGG - Intergenic
1041043142 8:53866718-53866740 CGTGGGGAATGGAGTGGGGTGGG + Intronic
1041906292 8:63037287-63037309 CATAGGAAATGGAGTGGTACAGG + Intronic
1042307481 8:67346545-67346567 CATGGAGAATGGATTGGAGGGGG + Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1042655442 8:71090646-71090668 CATTGAGAACAGACTGGAGCAGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044946872 8:97397513-97397535 GGGTGGGAATGGAGTGGGGCTGG - Intergenic
1045081587 8:98631187-98631209 CATTGAGAAGGGATTGTAGCAGG - Intronic
1045951616 8:107857778-107857800 TATGGGGAATGGACTGTAGCAGG + Intergenic
1046780164 8:118206146-118206168 CATTGGAAATGGAGACAAGCTGG - Intronic
1047384389 8:124395745-124395767 CATGGGGAATGGGGTATAGCAGG + Intergenic
1049460237 8:142723904-142723926 CATTGAGAATGGAGAGGTTCAGG - Intergenic
1049481151 8:142823607-142823629 CATTGAGAATGGAGAGGTTCAGG + Intergenic
1053153666 9:35758646-35758668 CACTGGGAATAGAGTAGGGCTGG - Intergenic
1053276139 9:36784836-36784858 GATTGTGAATGGAGTTGAGGAGG + Intergenic
1056164439 9:83927692-83927714 AATAGGGAATGGGGTGGAGGCGG - Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1058462358 9:105195008-105195030 CGTTGGGAATGGAGTGTTGTTGG - Intergenic
1058990854 9:110254884-110254906 CCTGGGGAAGGGAGTGGGGCTGG - Intronic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1059511292 9:114850559-114850581 CTTTGGGAAAGGAATGGAGTAGG + Intergenic
1060158155 9:121334664-121334686 CAATGGGGATGGAGTGGTGGTGG - Intergenic
1060826719 9:126692007-126692029 CAGTGGGGAAGGACTGGAGCAGG + Intronic
1061265463 9:129502239-129502261 GATGTGGAATGGAGTGGGGCTGG + Intergenic
1203351111 Un_KI270442v1:82179-82201 CGATTGGAATGGAGTGGAACTGG + Intergenic
1188910326 X:35839591-35839613 CCTTGCCAATGGAGTGGACCAGG - Intergenic
1190595808 X:52052011-52052033 CATGGGAAATGGAGGGCAGCTGG + Exonic
1190613016 X:52202062-52202084 CATGGGAAATGGAGGGCAGCTGG - Exonic
1190905229 X:54720942-54720964 CATGGGGAATGGGGTAGGGCAGG - Intergenic
1191774067 X:64793352-64793374 GCTTGGGCATGGAGTGGAGAGGG - Intergenic
1192005376 X:67206398-67206420 GAATGGGAATATAGTGGAGCAGG - Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1194356923 X:92896594-92896616 CATTGAGAATGGATTGGGGGAGG - Intergenic
1194552854 X:95321980-95322002 ACTTGGGAATAGAGTGGAGAAGG - Intergenic
1197276957 X:124490489-124490511 GACTGGGAATGGAGTAGAACTGG - Intronic
1197394025 X:125903675-125903697 TATTGGTAATGGACTGGAGAGGG + Intergenic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1198109964 X:133494421-133494443 CACAAGGAATGAAGTGGAGCTGG - Intergenic
1199974103 X:152882282-152882304 TAATGGGAATGGAATGGAGGAGG + Intergenic
1200665255 Y:6013588-6013610 CATTGAGAATGGATTGGGGGAGG - Intergenic
1200747799 Y:6917666-6917688 CAATGGGGAGGCAGTGGAGCGGG + Intronic